Mutagenetix > Incidental Mutations

Incidental Mutation 'R5934:Musk'

462083

Institutional Source

Beutler Lab

Gene Symbol

Musk

Ensembl Gene

ENSMUSG00000057280

Gene Name

muscle, skeletal, receptor tyrosine kinase

Synonyms

MDK4, Nsk1, Nsk2, Nsk3

MMRRC Submission

044128-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R5934 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

58285960-58374303 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 58373613 bp

Zygosity

Heterozygous

Amino Acid Change

Leucine to Glutamine at position 838 (L838Q)

Ref Sequence

ENSEMBL: ENSMUSP00000136696 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000081919] [ENSMUST00000084578] [ENSMUST00000098057] [ENSMUST00000098059] [ENSMUST00000102893] [ENSMUST00000177951] [ENSMUST00000179951]

Predicted Effect

probably damaging
Transcript: ENSMUST00000081919
AA Change: L836Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000080590
Gene: ENSMUSG00000057280
AA Change: L836Q

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
IGc2	40	106	1.16e-8	SMART
IGc2	133	197	1.79e-14	SMART
IGc2	224	289	4.67e-4	SMART
Pfam:Fz	317	448	1.1e-27	PFAM
transmembrane domain	495	517	N/A	INTRINSIC
low complexity region	518	529	N/A	INTRINSIC
low complexity region	558	567	N/A	INTRINSIC
TyrKc	574	855	2.96e-140	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000084578
AA Change: L836Q

PolyPhen 2 Score 0.728 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000081625
Gene: ENSMUSG00000057280
AA Change: L836Q

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
IGc2	40	106	1.16e-8	SMART
IGc2	133	197	1.79e-14	SMART
IGc2	224	289	4.67e-4	SMART
Pfam:Fz	317	448	1.2e-28	PFAM
transmembrane domain	495	517	N/A	INTRINSIC
low complexity region	518	529	N/A	INTRINSIC
low complexity region	558	567	N/A	INTRINSIC
TyrKc	574	855	2.96e-140	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000098057
AA Change: L861Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000095665
Gene: ENSMUSG00000057280
AA Change: L861Q

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
IGc2	40	106	1.16e-8	SMART
IGc2	133	197	1.79e-14	SMART
IGc2	234	299	4.67e-4	SMART
Pfam:Fz	342	467	1.4e-15	PFAM
transmembrane domain	520	542	N/A	INTRINSIC
low complexity region	543	554	N/A	INTRINSIC
low complexity region	583	592	N/A	INTRINSIC
TyrKc	599	880	2.96e-140	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000098059
AA Change: L838Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000095667
Gene: ENSMUSG00000057280
AA Change: L838Q

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
IGc2	40	106	1.16e-8	SMART
IGc2	133	197	1.79e-14	SMART
IGc2	234	299	4.67e-4	SMART
low complexity region	303	318	N/A	INTRINSIC
Pfam:Fz	327	458	2.1e-28	PFAM
transmembrane domain	497	519	N/A	INTRINSIC
low complexity region	520	531	N/A	INTRINSIC
low complexity region	560	569	N/A	INTRINSIC
TyrKc	576	857	2.96e-140	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000102893
AA Change: L828Q

PolyPhen 2 Score 0.034 (Sensitivity: 0.95; Specificity: 0.82)

SMART Domains

Protein: ENSMUSP00000099957
Gene: ENSMUSG00000057280
AA Change: L828Q

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
IGc2	40	106	1.16e-8	SMART
IGc2	133	197	1.79e-14	SMART
IGc2	224	289	4.67e-4	SMART
Pfam:Fz	317	448	1.1e-27	PFAM
transmembrane domain	487	509	N/A	INTRINSIC
low complexity region	510	521	N/A	INTRINSIC
low complexity region	550	559	N/A	INTRINSIC
TyrKc	566	847	2.96e-140	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000177951
AA Change: L838Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000136696
Gene: ENSMUSG00000057280
AA Change: L838Q

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
IGc2	40	106	1.16e-8	SMART
IGc2	133	197	1.79e-14	SMART
IGc2	234	299	4.67e-4	SMART
Pfam:Fz	327	458	1.1e-27	PFAM
transmembrane domain	497	519	N/A	INTRINSIC
low complexity region	520	531	N/A	INTRINSIC
low complexity region	560	569	N/A	INTRINSIC
TyrKc	576	857	2.96e-140	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000179951
AA Change: L846Q

PolyPhen 2 Score 0.577 (Sensitivity: 0.88; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000137453
Gene: ENSMUSG00000057280
AA Change: L846Q

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
IGc2	40	106	1.16e-8	SMART
IGc2	133	197	1.79e-14	SMART
IGc2	234	299	4.67e-4	SMART
low complexity region	303	318	N/A	INTRINSIC
Pfam:Fz	327	458	1.2e-27	PFAM
transmembrane domain	505	527	N/A	INTRINSIC
low complexity region	528	539	N/A	INTRINSIC
low complexity region	568	577	N/A	INTRINSIC
TyrKc	584	865	2.96e-140	SMART

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.3%
20x: 95.3%

Validation Efficiency

MGI Phenotype

FUNCTION: This gene encodes a member of the protein tyrosine kinase family. The encoded protein is a type 1 receptor-like protein located in muscle membrane that is activated by the heparan sulfate proteoglycan agrin released by nerve cells. The encoded protein activates signaling cascades responsible for multiple aspects of motor neuron and muscle development, including organization of the postsynaptic membrane, synaptic gene transcription, patterning of skeletal muscle, anchoring of acetylcholinesterase, and guidance of motor axons. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation lack neuromuscular synapses and spontaneous movement, and die at birth of respiratory failure. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 67 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcb4	T	C	5: 8,930,806	V596A	probably benign	Het
Acot11	C	T	4: 106,760,130	G240R	probably damaging	Het
Afg1l	G	A	10: 42,318,686	T370M	probably damaging	Het
Aldh2	T	C	5: 121,579,615	T118A	probably benign	Het
Apcdd1	C	T	18: 62,951,869	A379V	possibly damaging	Het
Atp1a3	T	C	7: 24,978,874		probably benign	Het
Cd96	G	T	16: 46,117,903	D66E	probably benign	Het
Cdh5	T	A	8: 104,138,268	V506E	probably benign	Het
Cep70	T	C	9: 99,254,265	I7T	probably benign	Het
Ckb	A	T	12: 111,670,229	V237D	probably damaging	Het
Col6a6	C	T	9: 105,767,075	D1306N	probably damaging	Het
Cysltr2	T	C	14: 73,029,491	K260E	probably benign	Het
D1Ertd622e	A	T	1: 97,645,930	C137S	possibly damaging	Het
Ddhd2	A	G	8: 25,753,113	S19P	probably damaging	Het
Dnah17	G	T	11: 118,041,102	D3681E	probably benign	Het
Dopey1	T	A	9: 86,542,442	Y2068*	probably null	Het
Fam26e	A	G	10: 34,092,202	V285A	possibly damaging	Het
Fryl	T	C	5: 73,090,717	Y1019C	probably damaging	Het
Fsip2	G	A	2: 82,986,748	C4275Y	possibly damaging	Het
Gapdh	A	G	6: 125,162,701	V202A	probably damaging	Het
Gm8394	T	C	10: 85,314,281		noncoding transcript	Het
Gmeb2	T	C	2: 181,255,574	I250M	possibly damaging	Het
Gpr88	C	T	3: 116,252,309	G118R	probably damaging	Het
Hdhd3	C	A	4: 62,499,370	V190L	possibly damaging	Het
Heg1	C	T	16: 33,726,919	T461M	probably damaging	Het
Hspg2	A	G	4: 137,518,772	Y989C	probably damaging	Het
Ift74	A	T	4: 94,632,734	M175L	probably benign	Het
Kcnh3	G	A	15: 99,226,533	R101Q	possibly damaging	Het
Kif20b	G	T	19: 34,941,321	V702F	probably benign	Het
Klhl1	A	G	14: 96,123,215		probably null	Het
Lrrk2	T	C	15: 91,734,046	V916A	probably benign	Het
Mpp4	A	T	1: 59,121,376	D589E	probably damaging	Het
Msl2	T	C	9: 101,101,818	C464R	probably damaging	Het
Mucl2	A	T	15: 103,897,566	S42T	probably benign	Het
Nos1	A	G	5: 117,936,445	H1052R	probably damaging	Het
Olfr1151	T	C	2: 87,857,241	V22A	probably benign	Het
Olfr1420	A	G	19: 11,896,929	R303G	probably benign	Het
Olfr352	T	A	2: 36,870,268	I234N	probably benign	Het
Olfr463	T	C	11: 87,893,223	R234G	possibly damaging	Het
Olfr52	T	A	2: 86,182,102	Q3L	probably benign	Het
Olfr521	A	T	7: 99,767,389	I76F	probably damaging	Het
Olfr672	C	A	7: 104,996,178	C242F	probably damaging	Het
Olfr683	G	A	7: 105,143,660	S211F	probably benign	Het
Olfr960	C	T	9: 39,623,183	T20I	probably damaging	Het
Pard3	T	G	8: 127,389,338	L636R	probably damaging	Het
Pigr	A	T	1: 130,844,527	S161C	probably damaging	Het
Polr1e	T	C	4: 45,029,369	S325P	probably damaging	Het
Prrc2a	A	T	17: 35,150,084	V1992E	probably damaging	Het
Ptpdc1	T	C	13: 48,586,369	K468E	probably benign	Het
Rab22a	A	G	2: 173,661,504	T37A	probably damaging	Het
Rai14	T	A	15: 10,575,159	K571I	probably damaging	Het
Reck	G	A	4: 43,930,979	G660D	probably damaging	Het
Rgs4	T	C	1: 169,745,238	D43G	possibly damaging	Het
Ryr2	A	T	13: 11,584,154	D4645E	probably damaging	Het
Sf3b3	A	G	8: 110,823,470	S639P	probably damaging	Het
Slc27a4	G	T	2: 29,811,660	R430L	probably damaging	Het
Slfn1	T	A	11: 83,121,944	Y295*	probably null	Het
Slfn5	C	T	11: 82,956,592	S101L	probably damaging	Het
Sult1d1	CCATG	CCATGGCATG	5: 87,559,770		probably null	Het
Tchh	A	T	3: 93,444,112	Q286H	unknown	Het
Tmem184c	A	T	8: 77,604,723	Y172*	probably null	Het
Tsc22d1	T	G	14: 76,418,826	M833R	possibly damaging	Het
Ugt1a7c	G	T	1: 88,095,879	L253F	probably damaging	Het
Usp19	C	T	9: 108,492,567		probably benign	Het
Xirp2	T	A	2: 67,524,804	I3303K	possibly damaging	Het
Zfp574	G	A	7: 25,080,332	A260T	probably benign	Het
Zswim6	A	G	13: 107,744,107		noncoding transcript	Het

Other mutations in Musk

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01406:Musk	APN	4	58367539	missense	probably damaging	1.00
IGL01727:Musk	APN	4	58303887	missense	probably benign	0.37
IGL01981:Musk	APN	4	58296629	missense	probably damaging	1.00
IGL02064:Musk	APN	4	58286128	missense	possibly damaging	0.89
IGL02326:Musk	APN	4	58354113	missense	probably benign	0.02
IGL02475:Musk	APN	4	58353936	critical splice acceptor site	probably benign
IGL02585:Musk	APN	4	58347849	missense	probably benign
IGL02719:Musk	APN	4	58356496	missense	probably benign
IGL02797:Musk	APN	4	58366921	missense	probably benign	0.00
IGL02869:Musk	APN	4	58354078	missense	probably benign	0.05
IGL02940:Musk	APN	4	58373364	missense	probably damaging	1.00
IGL03167:Musk	APN	4	58366821	missense	possibly damaging	0.81
IGL03230:Musk	APN	4	58296710	missense	probably damaging	1.00
BB002:Musk	UTSW	4	58367513	missense	probably damaging	1.00
BB012:Musk	UTSW	4	58367513	missense	probably damaging	1.00
R0384:Musk	UTSW	4	58373711	makesense	probably null
R1014:Musk	UTSW	4	58354156	missense	possibly damaging	0.88
R1462:Musk	UTSW	4	58286204	splice site	probably benign
R1493:Musk	UTSW	4	58354003	missense	probably benign	0.19
R1739:Musk	UTSW	4	58293563	missense	probably damaging	1.00
R1883:Musk	UTSW	4	58373189	missense	probably benign	0.18
R2230:Musk	UTSW	4	58333672	missense	possibly damaging	0.79
R2914:Musk	UTSW	4	58366938	missense	probably damaging	0.99
R3508:Musk	UTSW	4	58327347	missense	probably damaging	0.98
R4225:Musk	UTSW	4	58373240	missense	probably damaging	0.99
R4601:Musk	UTSW	4	58301625	missense	probably damaging	0.99
R4771:Musk	UTSW	4	58301706	missense	probably benign	0.16
R4793:Musk	UTSW	4	58373400	missense	probably damaging	1.00
R4845:Musk	UTSW	4	58296679	missense	probably damaging	1.00
R4919:Musk	UTSW	4	58366899	missense	probably damaging	1.00
R4954:Musk	UTSW	4	58344222	missense	probably damaging	0.96
R5596:Musk	UTSW	4	58373036	missense	probably damaging	1.00
R5715:Musk	UTSW	4	58333663	missense	probably damaging	1.00
R5894:Musk	UTSW	4	58373583	missense	probably damaging	1.00
R6230:Musk	UTSW	4	58367576	missense	probably damaging	1.00
R6335:Musk	UTSW	4	58366811	missense	probably benign
R6358:Musk	UTSW	4	58373171	missense	possibly damaging	0.72
R6395:Musk	UTSW	4	58286169	missense	probably benign
R6652:Musk	UTSW	4	58368977	missense	probably damaging	1.00
R6764:Musk	UTSW	4	58354027	missense	probably damaging	1.00
R7233:Musk	UTSW	4	58373307	missense	possibly damaging	0.83
R7238:Musk	UTSW	4	58344312	missense	probably benign	0.01
R7271:Musk	UTSW	4	58373409	missense	probably damaging	1.00
R7511:Musk	UTSW	4	58333672	missense	probably benign	0.10
R7925:Musk	UTSW	4	58367513	missense	probably damaging	1.00
R8085:Musk	UTSW	4	58373110	missense	probably benign	0.00
R8243:Musk	UTSW	4	58293600	missense	probably benign
R8249:Musk	UTSW	4	58368926	missense	probably damaging	1.00
R8501:Musk	UTSW	4	58367502	missense	probably damaging	1.00
X0020:Musk	UTSW	4	58368996	missense	probably damaging	1.00
X0066:Musk	UTSW	4	58327356	critical splice donor site	probably null

Predicted Primers

PCR Primer
(F):5'- ACCACTGAGTCGGATGTATGG -3'
(R):5'- CAATCAACTGGCACGTGATGTC -3'

Sequencing Primer
(F):5'- AGTCGGATGTATGGGCCTATG -3'
(R):5'- GCACGTGATGTCTGAGTTAAACTCC -3'

Posted On

2017-02-28