Incidental Mutation 'R5934:Musk'
ID462083
Institutional Source Beutler Lab
Gene Symbol Musk
Ensembl Gene ENSMUSG00000057280
Gene Namemuscle, skeletal, receptor tyrosine kinase
SynonymsMDK4, Nsk1, Nsk2, Nsk3
MMRRC Submission 044128-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5934 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location58285960-58374303 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 58373613 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 838 (L838Q)
Ref Sequence ENSEMBL: ENSMUSP00000136696 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081919] [ENSMUST00000084578] [ENSMUST00000098057] [ENSMUST00000098059] [ENSMUST00000102893] [ENSMUST00000177951] [ENSMUST00000179951]
Predicted Effect probably damaging
Transcript: ENSMUST00000081919
AA Change: L836Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000080590
Gene: ENSMUSG00000057280
AA Change: L836Q

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
IGc2 40 106 1.16e-8 SMART
IGc2 133 197 1.79e-14 SMART
IGc2 224 289 4.67e-4 SMART
Pfam:Fz 317 448 1.1e-27 PFAM
transmembrane domain 495 517 N/A INTRINSIC
low complexity region 518 529 N/A INTRINSIC
low complexity region 558 567 N/A INTRINSIC
TyrKc 574 855 2.96e-140 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000084578
AA Change: L836Q

PolyPhen 2 Score 0.728 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000081625
Gene: ENSMUSG00000057280
AA Change: L836Q

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
IGc2 40 106 1.16e-8 SMART
IGc2 133 197 1.79e-14 SMART
IGc2 224 289 4.67e-4 SMART
Pfam:Fz 317 448 1.2e-28 PFAM
transmembrane domain 495 517 N/A INTRINSIC
low complexity region 518 529 N/A INTRINSIC
low complexity region 558 567 N/A INTRINSIC
TyrKc 574 855 2.96e-140 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000098057
AA Change: L861Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000095665
Gene: ENSMUSG00000057280
AA Change: L861Q

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
IGc2 40 106 1.16e-8 SMART
IGc2 133 197 1.79e-14 SMART
IGc2 234 299 4.67e-4 SMART
Pfam:Fz 342 467 1.4e-15 PFAM
transmembrane domain 520 542 N/A INTRINSIC
low complexity region 543 554 N/A INTRINSIC
low complexity region 583 592 N/A INTRINSIC
TyrKc 599 880 2.96e-140 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000098059
AA Change: L838Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000095667
Gene: ENSMUSG00000057280
AA Change: L838Q

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
IGc2 40 106 1.16e-8 SMART
IGc2 133 197 1.79e-14 SMART
IGc2 234 299 4.67e-4 SMART
low complexity region 303 318 N/A INTRINSIC
Pfam:Fz 327 458 2.1e-28 PFAM
transmembrane domain 497 519 N/A INTRINSIC
low complexity region 520 531 N/A INTRINSIC
low complexity region 560 569 N/A INTRINSIC
TyrKc 576 857 2.96e-140 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000102893
AA Change: L828Q

PolyPhen 2 Score 0.034 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000099957
Gene: ENSMUSG00000057280
AA Change: L828Q

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
IGc2 40 106 1.16e-8 SMART
IGc2 133 197 1.79e-14 SMART
IGc2 224 289 4.67e-4 SMART
Pfam:Fz 317 448 1.1e-27 PFAM
transmembrane domain 487 509 N/A INTRINSIC
low complexity region 510 521 N/A INTRINSIC
low complexity region 550 559 N/A INTRINSIC
TyrKc 566 847 2.96e-140 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000177951
AA Change: L838Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000136696
Gene: ENSMUSG00000057280
AA Change: L838Q

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
IGc2 40 106 1.16e-8 SMART
IGc2 133 197 1.79e-14 SMART
IGc2 234 299 4.67e-4 SMART
Pfam:Fz 327 458 1.1e-27 PFAM
transmembrane domain 497 519 N/A INTRINSIC
low complexity region 520 531 N/A INTRINSIC
low complexity region 560 569 N/A INTRINSIC
TyrKc 576 857 2.96e-140 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000179951
AA Change: L846Q

PolyPhen 2 Score 0.577 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000137453
Gene: ENSMUSG00000057280
AA Change: L846Q

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
IGc2 40 106 1.16e-8 SMART
IGc2 133 197 1.79e-14 SMART
IGc2 234 299 4.67e-4 SMART
low complexity region 303 318 N/A INTRINSIC
Pfam:Fz 327 458 1.2e-27 PFAM
transmembrane domain 505 527 N/A INTRINSIC
low complexity region 528 539 N/A INTRINSIC
low complexity region 568 577 N/A INTRINSIC
TyrKc 584 865 2.96e-140 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the protein tyrosine kinase family. The encoded protein is a type 1 receptor-like protein located in muscle membrane that is activated by the heparan sulfate proteoglycan agrin released by nerve cells. The encoded protein activates signaling cascades responsible for multiple aspects of motor neuron and muscle development, including organization of the postsynaptic membrane, synaptic gene transcription, patterning of skeletal muscle, anchoring of acetylcholinesterase, and guidance of motor axons. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation lack neuromuscular synapses and spontaneous movement, and die at birth of respiratory failure. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb4 T C 5: 8,930,806 V596A probably benign Het
Acot11 C T 4: 106,760,130 G240R probably damaging Het
Afg1l G A 10: 42,318,686 T370M probably damaging Het
Aldh2 T C 5: 121,579,615 T118A probably benign Het
Apcdd1 C T 18: 62,951,869 A379V possibly damaging Het
Atp1a3 T C 7: 24,978,874 probably benign Het
Cd96 G T 16: 46,117,903 D66E probably benign Het
Cdh5 T A 8: 104,138,268 V506E probably benign Het
Cep70 T C 9: 99,254,265 I7T probably benign Het
Ckb A T 12: 111,670,229 V237D probably damaging Het
Col6a6 C T 9: 105,767,075 D1306N probably damaging Het
Cysltr2 T C 14: 73,029,491 K260E probably benign Het
D1Ertd622e A T 1: 97,645,930 C137S possibly damaging Het
Ddhd2 A G 8: 25,753,113 S19P probably damaging Het
Dnah17 G T 11: 118,041,102 D3681E probably benign Het
Dopey1 T A 9: 86,542,442 Y2068* probably null Het
Fam26e A G 10: 34,092,202 V285A possibly damaging Het
Fryl T C 5: 73,090,717 Y1019C probably damaging Het
Fsip2 G A 2: 82,986,748 C4275Y possibly damaging Het
Gapdh A G 6: 125,162,701 V202A probably damaging Het
Gm8394 T C 10: 85,314,281 noncoding transcript Het
Gmeb2 T C 2: 181,255,574 I250M possibly damaging Het
Gpr88 C T 3: 116,252,309 G118R probably damaging Het
Hdhd3 C A 4: 62,499,370 V190L possibly damaging Het
Heg1 C T 16: 33,726,919 T461M probably damaging Het
Hspg2 A G 4: 137,518,772 Y989C probably damaging Het
Ift74 A T 4: 94,632,734 M175L probably benign Het
Kcnh3 G A 15: 99,226,533 R101Q possibly damaging Het
Kif20b G T 19: 34,941,321 V702F probably benign Het
Klhl1 A G 14: 96,123,215 probably null Het
Lrrk2 T C 15: 91,734,046 V916A probably benign Het
Mpp4 A T 1: 59,121,376 D589E probably damaging Het
Msl2 T C 9: 101,101,818 C464R probably damaging Het
Mucl2 A T 15: 103,897,566 S42T probably benign Het
Nos1 A G 5: 117,936,445 H1052R probably damaging Het
Olfr1151 T C 2: 87,857,241 V22A probably benign Het
Olfr1420 A G 19: 11,896,929 R303G probably benign Het
Olfr352 T A 2: 36,870,268 I234N probably benign Het
Olfr463 T C 11: 87,893,223 R234G possibly damaging Het
Olfr52 T A 2: 86,182,102 Q3L probably benign Het
Olfr521 A T 7: 99,767,389 I76F probably damaging Het
Olfr672 C A 7: 104,996,178 C242F probably damaging Het
Olfr683 G A 7: 105,143,660 S211F probably benign Het
Olfr960 C T 9: 39,623,183 T20I probably damaging Het
Pard3 T G 8: 127,389,338 L636R probably damaging Het
Pigr A T 1: 130,844,527 S161C probably damaging Het
Polr1e T C 4: 45,029,369 S325P probably damaging Het
Prrc2a A T 17: 35,150,084 V1992E probably damaging Het
Ptpdc1 T C 13: 48,586,369 K468E probably benign Het
Rab22a A G 2: 173,661,504 T37A probably damaging Het
Rai14 T A 15: 10,575,159 K571I probably damaging Het
Reck G A 4: 43,930,979 G660D probably damaging Het
Rgs4 T C 1: 169,745,238 D43G possibly damaging Het
Ryr2 A T 13: 11,584,154 D4645E probably damaging Het
Sf3b3 A G 8: 110,823,470 S639P probably damaging Het
Slc27a4 G T 2: 29,811,660 R430L probably damaging Het
Slfn1 T A 11: 83,121,944 Y295* probably null Het
Slfn5 C T 11: 82,956,592 S101L probably damaging Het
Sult1d1 CCATG CCATGGCATG 5: 87,559,770 probably null Het
Tchh A T 3: 93,444,112 Q286H unknown Het
Tmem184c A T 8: 77,604,723 Y172* probably null Het
Tsc22d1 T G 14: 76,418,826 M833R possibly damaging Het
Ugt1a7c G T 1: 88,095,879 L253F probably damaging Het
Usp19 C T 9: 108,492,567 probably benign Het
Xirp2 T A 2: 67,524,804 I3303K possibly damaging Het
Zfp574 G A 7: 25,080,332 A260T probably benign Het
Zswim6 A G 13: 107,744,107 noncoding transcript Het
Other mutations in Musk
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01406:Musk APN 4 58367539 missense probably damaging 1.00
IGL01727:Musk APN 4 58303887 missense probably benign 0.37
IGL01981:Musk APN 4 58296629 missense probably damaging 1.00
IGL02064:Musk APN 4 58286128 missense possibly damaging 0.89
IGL02326:Musk APN 4 58354113 missense probably benign 0.02
IGL02475:Musk APN 4 58353936 critical splice acceptor site probably benign
IGL02585:Musk APN 4 58347849 missense probably benign
IGL02719:Musk APN 4 58356496 missense probably benign
IGL02797:Musk APN 4 58366921 missense probably benign 0.00
IGL02869:Musk APN 4 58354078 missense probably benign 0.05
IGL02940:Musk APN 4 58373364 missense probably damaging 1.00
IGL03167:Musk APN 4 58366821 missense possibly damaging 0.81
IGL03230:Musk APN 4 58296710 missense probably damaging 1.00
R0384:Musk UTSW 4 58373711 makesense probably null
R1014:Musk UTSW 4 58354156 missense possibly damaging 0.88
R1462:Musk UTSW 4 58286204 splice site probably benign
R1493:Musk UTSW 4 58354003 missense probably benign 0.19
R1739:Musk UTSW 4 58293563 missense probably damaging 1.00
R1883:Musk UTSW 4 58373189 missense probably benign 0.18
R2230:Musk UTSW 4 58333672 missense possibly damaging 0.79
R2914:Musk UTSW 4 58366938 missense probably damaging 0.99
R3508:Musk UTSW 4 58327347 missense probably damaging 0.98
R4225:Musk UTSW 4 58373240 missense probably damaging 0.99
R4601:Musk UTSW 4 58301625 missense probably damaging 0.99
R4771:Musk UTSW 4 58301706 missense probably benign 0.16
R4793:Musk UTSW 4 58373400 missense probably damaging 1.00
R4845:Musk UTSW 4 58296679 missense probably damaging 1.00
R4919:Musk UTSW 4 58366899 missense probably damaging 1.00
R4954:Musk UTSW 4 58344222 missense probably damaging 0.96
R5596:Musk UTSW 4 58373036 missense probably damaging 1.00
R5715:Musk UTSW 4 58333663 missense probably damaging 1.00
R5894:Musk UTSW 4 58373583 missense probably damaging 1.00
R6230:Musk UTSW 4 58367576 missense probably damaging 1.00
R6335:Musk UTSW 4 58366811 missense probably benign
R6358:Musk UTSW 4 58373171 missense possibly damaging 0.72
R6395:Musk UTSW 4 58286169 missense probably benign
R6652:Musk UTSW 4 58368977 missense probably damaging 1.00
R6764:Musk UTSW 4 58354027 missense probably damaging 1.00
R7233:Musk UTSW 4 58373307 missense possibly damaging 0.83
R7238:Musk UTSW 4 58344312 missense probably benign 0.01
R7271:Musk UTSW 4 58373409 missense probably damaging 1.00
R7511:Musk UTSW 4 58333672 missense probably benign 0.10
X0020:Musk UTSW 4 58368996 missense probably damaging 1.00
X0066:Musk UTSW 4 58327356 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- ACCACTGAGTCGGATGTATGG -3'
(R):5'- CAATCAACTGGCACGTGATGTC -3'

Sequencing Primer
(F):5'- AGTCGGATGTATGGGCCTATG -3'
(R):5'- GCACGTGATGTCTGAGTTAAACTCC -3'
Posted On2017-02-28