Mutagenetix > Incidental Mutations

Incidental Mutation 'R5934:Apcdd1'

462138

Institutional Source

Beutler Lab

Gene Symbol

Apcdd1

Ensembl Gene

ENSMUSG00000071847

Gene Name

adenomatosis polyposis coli down-regulated 1

Synonyms

Drapc1, EIG180

MMRRC Submission

044128-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.150) question?

Stock #

R5934 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

62922327-62953195 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 62951869 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Alanine to Valine at position 379 (A379V)

Ref Sequence

ENSEMBL: ENSMUSP00000125868 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000096554] [ENSMUST00000163716]

AlphaFold

Q3U128

Predicted Effect

possibly damaging
Transcript: ENSMUST00000096554
AA Change: A379V

PolyPhen 2 Score 0.719 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000094302
Gene: ENSMUSG00000071847
AA Change: A379V

Domain	Start	End	E-Value	Type
signal peptide	1	26	N/A	INTRINSIC
APCDDC	51	283	3.3e-140	SMART
APCDDC	284	500	6.26e-91	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000163716
AA Change: A379V

PolyPhen 2 Score 0.719 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000125868
Gene: ENSMUSG00000071847
AA Change: A379V

Domain	Start	End	E-Value	Type
signal peptide	1	26	N/A	INTRINSIC
APCDDC	51	283	3.3e-140	SMART
APCDDC	284	500	6.26e-91	SMART

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.3%
20x: 95.3%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This locus encodes an inhibitor of the Wnt signaling pathway. Mutations at this locus have been associated with hereditary hypotrichosis simplex. Increased expression of this gene may also be associated with colorectal carcinogenesis.[provided by RefSeq, Sep 2010]

Allele List at MGI

Other mutations in this stock

Total: 67 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcb4	T	C	5: 8,930,806	V596A	probably benign	Het
Acot11	C	T	4: 106,760,130	G240R	probably damaging	Het
Afg1l	G	A	10: 42,318,686	T370M	probably damaging	Het
Aldh2	T	C	5: 121,579,615	T118A	probably benign	Het
Atp1a3	T	C	7: 24,978,874		probably benign	Het
Cd96	G	T	16: 46,117,903	D66E	probably benign	Het
Cdh5	T	A	8: 104,138,268	V506E	probably benign	Het
Cep70	T	C	9: 99,254,265	I7T	probably benign	Het
Ckb	A	T	12: 111,670,229	V237D	probably damaging	Het
Col6a6	C	T	9: 105,767,075	D1306N	probably damaging	Het
Cysltr2	T	C	14: 73,029,491	K260E	probably benign	Het
D1Ertd622e	A	T	1: 97,645,930	C137S	possibly damaging	Het
Ddhd2	A	G	8: 25,753,113	S19P	probably damaging	Het
Dnah17	G	T	11: 118,041,102	D3681E	probably benign	Het
Dopey1	T	A	9: 86,542,442	Y2068*	probably null	Het
Fam26e	A	G	10: 34,092,202	V285A	possibly damaging	Het
Fryl	T	C	5: 73,090,717	Y1019C	probably damaging	Het
Fsip2	G	A	2: 82,986,748	C4275Y	possibly damaging	Het
Gapdh	A	G	6: 125,162,701	V202A	probably damaging	Het
Gm8394	T	C	10: 85,314,281		noncoding transcript	Het
Gmeb2	T	C	2: 181,255,574	I250M	possibly damaging	Het
Gpr88	C	T	3: 116,252,309	G118R	probably damaging	Het
Hdhd3	C	A	4: 62,499,370	V190L	possibly damaging	Het
Heg1	C	T	16: 33,726,919	T461M	probably damaging	Het
Hspg2	A	G	4: 137,518,772	Y989C	probably damaging	Het
Ift74	A	T	4: 94,632,734	M175L	probably benign	Het
Kcnh3	G	A	15: 99,226,533	R101Q	possibly damaging	Het
Kif20b	G	T	19: 34,941,321	V702F	probably benign	Het
Klhl1	A	G	14: 96,123,215		probably null	Het
Lrrk2	T	C	15: 91,734,046	V916A	probably benign	Het
Mpp4	A	T	1: 59,121,376	D589E	probably damaging	Het
Msl2	T	C	9: 101,101,818	C464R	probably damaging	Het
Mucl2	A	T	15: 103,897,566	S42T	probably benign	Het
Musk	T	A	4: 58,373,613	L838Q	probably damaging	Het
Nos1	A	G	5: 117,936,445	H1052R	probably damaging	Het
Olfr1151	T	C	2: 87,857,241	V22A	probably benign	Het
Olfr1420	A	G	19: 11,896,929	R303G	probably benign	Het
Olfr352	T	A	2: 36,870,268	I234N	probably benign	Het
Olfr463	T	C	11: 87,893,223	R234G	possibly damaging	Het
Olfr52	T	A	2: 86,182,102	Q3L	probably benign	Het
Olfr521	A	T	7: 99,767,389	I76F	probably damaging	Het
Olfr672	C	A	7: 104,996,178	C242F	probably damaging	Het
Olfr683	G	A	7: 105,143,660	S211F	probably benign	Het
Olfr960	C	T	9: 39,623,183	T20I	probably damaging	Het
Pard3	T	G	8: 127,389,338	L636R	probably damaging	Het
Pigr	A	T	1: 130,844,527	S161C	probably damaging	Het
Polr1e	T	C	4: 45,029,369	S325P	probably damaging	Het
Prrc2a	A	T	17: 35,150,084	V1992E	probably damaging	Het
Ptpdc1	T	C	13: 48,586,369	K468E	probably benign	Het
Rab22a	A	G	2: 173,661,504	T37A	probably damaging	Het
Rai14	T	A	15: 10,575,159	K571I	probably damaging	Het
Reck	G	A	4: 43,930,979	G660D	probably damaging	Het
Rgs4	T	C	1: 169,745,238	D43G	possibly damaging	Het
Ryr2	A	T	13: 11,584,154	D4645E	probably damaging	Het
Sf3b3	A	G	8: 110,823,470	S639P	probably damaging	Het
Slc27a4	G	T	2: 29,811,660	R430L	probably damaging	Het
Slfn1	T	A	11: 83,121,944	Y295*	probably null	Het
Slfn5	C	T	11: 82,956,592	S101L	probably damaging	Het
Sult1d1	CCATG	CCATGGCATG	5: 87,559,770		probably null	Het
Tchh	A	T	3: 93,444,112	Q286H	unknown	Het
Tmem184c	A	T	8: 77,604,723	Y172*	probably null	Het
Tsc22d1	T	G	14: 76,418,826	M833R	possibly damaging	Het
Ugt1a7c	G	T	1: 88,095,879	L253F	probably damaging	Het
Usp19	C	T	9: 108,492,567		probably benign	Het
Xirp2	T	A	2: 67,524,804	I3303K	possibly damaging	Het
Zfp574	G	A	7: 25,080,332	A260T	probably benign	Het
Zswim6	A	G	13: 107,744,107		noncoding transcript	Het

Other mutations in Apcdd1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00805:Apcdd1	APN	18	62933865	splice site	probably benign
IGL01522:Apcdd1	APN	18	62952115	missense	possibly damaging	0.50
IGL01637:Apcdd1	APN	18	62937286	missense	probably damaging	1.00
IGL02069:Apcdd1	APN	18	62949983	missense	probably damaging	1.00
IGL02183:Apcdd1	APN	18	62951854	missense	probably damaging	0.98
IGL02268:Apcdd1	APN	18	62950188	missense	probably damaging	0.99
IGL02664:Apcdd1	APN	18	62951820	splice site	probably benign
R0207:Apcdd1	UTSW	18	62950079	missense	probably benign	0.04
R0363:Apcdd1	UTSW	18	62937097	missense	possibly damaging	0.46
R0540:Apcdd1	UTSW	18	62951896	missense	possibly damaging	0.82
R0567:Apcdd1	UTSW	18	62934036	missense	possibly damaging	0.93
R0607:Apcdd1	UTSW	18	62951896	missense	possibly damaging	0.82
R0629:Apcdd1	UTSW	18	62933970	missense	probably damaging	1.00
R1118:Apcdd1	UTSW	18	62952024	missense	probably benign
R1178:Apcdd1	UTSW	18	62937097	missense	probably damaging	1.00
R1180:Apcdd1	UTSW	18	62937097	missense	probably damaging	1.00
R1181:Apcdd1	UTSW	18	62937097	missense	probably damaging	1.00
R4363:Apcdd1	UTSW	18	62951932	missense	possibly damaging	0.95
R5534:Apcdd1	UTSW	18	62937034	missense	probably benign	0.01
R5622:Apcdd1	UTSW	18	62936902	splice site	probably null
R5771:Apcdd1	UTSW	18	62936956	missense	probably damaging	1.00
R5852:Apcdd1	UTSW	18	62937063	missense	probably damaging	1.00
R6109:Apcdd1	UTSW	18	62937366	missense	probably damaging	1.00
R6515:Apcdd1	UTSW	18	62951839	missense	probably damaging	1.00
R6625:Apcdd1	UTSW	18	62951858	missense	probably damaging	1.00
R6831:Apcdd1	UTSW	18	62950126	nonsense	probably null
R6931:Apcdd1	UTSW	18	62933908	missense	probably damaging	1.00
R7018:Apcdd1	UTSW	18	62937049	missense	probably damaging	0.98
R7115:Apcdd1	UTSW	18	62936953	missense	probably damaging	1.00
R7148:Apcdd1	UTSW	18	62951845	missense	probably damaging	1.00
R7326:Apcdd1	UTSW	18	62952188	nonsense	probably null
R8025:Apcdd1	UTSW	18	62936908	missense	probably damaging	1.00
R8114:Apcdd1	UTSW	18	62950056	missense	probably damaging	1.00
R8261:Apcdd1	UTSW	18	62933903	missense	possibly damaging	0.86
R8404:Apcdd1	UTSW	18	62933915	missense	possibly damaging	0.66
R9015:Apcdd1	UTSW	18	62950086	missense	possibly damaging	0.93
R9040:Apcdd1	UTSW	18	62937343	missense	probably damaging	0.96
R9288:Apcdd1	UTSW	18	62922660	start gained	probably benign
R9295:Apcdd1	UTSW	18	62922660	start gained	probably benign
R9297:Apcdd1	UTSW	18	62922660	start gained	probably benign
R9317:Apcdd1	UTSW	18	62922660	start gained	probably benign
R9319:Apcdd1	UTSW	18	62922660	start gained	probably benign
R9393:Apcdd1	UTSW	18	62922660	start gained	probably benign
R9394:Apcdd1	UTSW	18	62922660	start gained	probably benign
R9396:Apcdd1	UTSW	18	62922660	start gained	probably benign
R9397:Apcdd1	UTSW	18	62922660	start gained	probably benign
X0028:Apcdd1	UTSW	18	62937130	missense	possibly damaging	0.59
Z1088:Apcdd1	UTSW	18	62937183	missense	probably benign	0.18
Z1177:Apcdd1	UTSW	18	62922691	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- ATGGAACTTCCTACCAGAGCCTAC -3'
(R):5'- TCTGGCCATTGAACAGCAGG -3'

Sequencing Primer
(F):5'- TTTTTGATTACTGTGGTCAGCC -3'
(R):5'- GTAGCGGCCTCGGGTGTC -3'

Posted On

2017-02-28