Incidental Mutation 'R0440:App'
ID46721
Institutional Source Beutler Lab
Gene Symbol App
Ensembl Gene ENSMUSG00000022892
Gene Nameamyloid beta (A4) precursor protein
SynonymsAdap, Abeta, protease nexin II, E030013M08Rik, betaAPP, appican, Cvap
MMRRC Submission 038641-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.614) question?
Stock #R0440 (G1)
Quality Score225
Status Validated (trace)
Chromosome16
Chromosomal Location84949685-85173766 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to A at 85056414 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Stop codon at position 259 (E259*)
Ref Sequence ENSEMBL: ENSMUSP00000154401 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005406] [ENSMUST00000226232] [ENSMUST00000226801] [ENSMUST00000227021] [ENSMUST00000227723] [ENSMUST00000227737]
Predicted Effect probably null
Transcript: ENSMUST00000005406
AA Change: E259*
SMART Domains Protein: ENSMUSP00000005406
Gene: ENSMUSG00000022892
AA Change: E259*

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
A4_EXTRA 24 188 5.33e-129 SMART
low complexity region 190 208 N/A INTRINSIC
Pfam:APP_E2 291 473 2.5e-77 PFAM
Pfam:Beta-APP 600 638 3.4e-28 PFAM
Pfam:APP_amyloid 641 691 8.6e-28 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000226232
AA Change: E259*
Predicted Effect probably null
Transcript: ENSMUST00000226801
AA Change: E259*
Predicted Effect probably null
Transcript: ENSMUST00000227021
AA Change: E259*
Predicted Effect probably null
Transcript: ENSMUST00000227723
AA Change: E259*
Predicted Effect probably null
Transcript: ENSMUST00000227737
AA Change: E259*
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227990
Meta Mutation Damage Score 0.9711 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.8%
  • 10x: 97.0%
  • 20x: 94.1%
Validation Efficiency 99% (68/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cell surface receptor and transmembrane precursor protein that is cleaved by secretases to form a number of peptides. Some of these peptides are secreted and can bind to the acetyltransferase complex APBB1/TIP60 to promote transcriptional activation, while others form the protein basis of the amyloid plaques found in the brains of patients with Alzheimer disease. In addition, two of the peptides are antimicrobial peptides, having been shown to have bacteriocidal and antifungal activities. Mutations in this gene have been implicated in autosomal dominant Alzheimer disease and cerebroarterial amyloidosis (cerebral amyloid angiopathy). Multiple transcript variants encoding several different isoforms have been found for this gene. [provided by RefSeq, Aug 2014]
PHENOTYPE: Mice homozygous for disruptions in this gene exhibit reduced body weight, brain weight, size of forebrain commissures, locomotor activity, forelimb grip strength, and spatial learning scores. Many mice also exhibit agenesis of the corpus callosum, and extensive reactive gliosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A4galt G A 15: 83,228,493 R30W probably damaging Het
Adam7 T C 14: 68,510,856 probably null Het
Agl A T 3: 116,758,806 L1158Q probably damaging Het
Akap9 T C 5: 4,064,569 S66P probably damaging Het
Akr1c20 T A 13: 4,487,208 D316V probably benign Het
Arhgef4 A G 1: 34,745,448 probably null Het
Armc9 G A 1: 86,194,262 probably null Het
Ass1 A T 2: 31,514,819 N371Y probably damaging Het
Btaf1 C T 19: 36,986,653 P875S probably damaging Het
Cc2d1b T A 4: 108,625,816 probably null Het
Ccar1 C T 10: 62,780,457 V165I possibly damaging Het
Ccdc106 A T 7: 5,060,245 I250F probably damaging Het
Ccny T C 18: 9,332,917 I205V probably benign Het
Cfap52 T A 11: 67,954,088 I52L probably benign Het
Chd8 T A 14: 52,204,826 T2096S possibly damaging Het
Clstn3 G A 6: 124,451,413 T423I probably damaging Het
Col13a1 T C 10: 61,867,483 D440G possibly damaging Het
Dclk3 G A 9: 111,469,163 V592M probably damaging Het
Ddx31 A T 2: 28,857,132 I208F probably damaging Het
Dlat A T 9: 50,645,119 probably null Het
Eml4 T C 17: 83,446,058 probably null Het
Enpp2 T A 15: 54,847,237 probably benign Het
Fryl T C 5: 73,086,972 S38G possibly damaging Het
Gcnt1 G A 19: 17,330,316 T15I probably benign Het
Gm21834 T C 17: 57,742,126 T32A possibly damaging Het
Golga2 A G 2: 32,302,933 D394G probably damaging Het
Gtf3c4 G T 2: 28,840,169 probably null Het
Igkv4-69 A G 6: 69,284,269 probably benign Het
Inpp5j T C 11: 3,501,150 R500G possibly damaging Het
Kif5b A T 18: 6,226,980 probably benign Het
Klhl36 A G 8: 119,876,551 E515G probably damaging Het
Lifr C T 15: 7,157,191 R59* probably null Het
Lrif1 A T 3: 106,734,398 Q10L possibly damaging Het
Lrp8 A G 4: 107,869,098 E908G probably damaging Het
Lrrc23 A T 6: 124,770,704 D307E probably benign Het
Mpv17l T C 16: 13,944,719 F27L probably damaging Het
Mta3 C T 17: 83,766,587 A76V probably damaging Het
Muc5ac T A 7: 141,792,034 Y202* probably null Het
Naprt A G 15: 75,891,069 probably benign Het
Npr2 T A 4: 43,650,315 V960D probably damaging Het
Oca2 A T 7: 56,423,352 Y765F probably benign Het
Olfr715 A T 7: 107,128,732 H220Q probably benign Het
Plxna2 T A 1: 194,644,404 Y215* probably null Het
Prdm16 G A 4: 154,476,627 probably benign Het
Ptn A G 6: 36,744,497 S3P probably benign Het
Pus10 T C 11: 23,673,331 probably benign Het
Rad21 A T 15: 51,968,358 D442E probably benign Het
Rmdn2 A G 17: 79,667,955 H291R probably damaging Het
Rp1 A G 1: 4,345,640 S1750P probably damaging Het
Samd4b A T 7: 28,408,160 I228N probably benign Het
Sdr9c7 G T 10: 127,898,953 probably benign Het
Slc13a2 T C 11: 78,403,175 N254D probably benign Het
Slc16a8 T A 15: 79,252,607 I132F probably damaging Het
Slc18b1 T A 10: 23,819,078 Y274N probably benign Het
Slc45a2 A T 15: 11,000,817 M1L probably benign Het
Smc1b A G 15: 85,112,673 probably benign Het
Stab2 T C 10: 86,949,928 S617G probably benign Het
Stk10 A G 11: 32,604,190 M626V probably damaging Het
Synpo2l T G 14: 20,661,398 I385L possibly damaging Het
Tmprss11d T C 5: 86,338,812 Y73C probably damaging Het
Ttc21b A G 2: 66,236,382 V309A probably benign Het
Tubgcp6 A G 15: 89,103,065 I1235T probably benign Het
Usp8 A G 2: 126,725,390 I110V probably benign Het
Vps13c G A 9: 67,972,861 G3442S probably damaging Het
Wdr59 GGGTGGTG GGGTG 8: 111,480,540 probably benign Het
Zfp207 T A 11: 80,395,507 probably benign Het
Zfp748 A C 13: 67,553,025 probably null Het
Other mutations in App
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00834:App APN 16 84965711 missense probably damaging 0.99
IGL01457:App APN 16 85103239 missense probably damaging 1.00
IGL02016:App APN 16 85056521 missense unknown
IGL02135:App APN 16 85079838 critical splice donor site probably null
IGL02338:App APN 16 85173519 missense probably benign 0.01
IGL02377:App APN 16 85082831 missense probably benign 0.07
IGL02516:App APN 16 84955417 missense probably damaging 1.00
IGL02565:App APN 16 85025420 splice site probably null
IGL03179:App APN 16 85082847 missense probably damaging 1.00
LCD18:App UTSW 16 85025412 splice site probably benign
R0349:App UTSW 16 85013680 missense probably damaging 1.00
R0515:App UTSW 16 85103344 splice site probably benign
R0730:App UTSW 16 85079952 missense probably damaging 0.98
R1609:App UTSW 16 85079949 missense probably damaging 0.97
R1703:App UTSW 16 84965768 missense probably damaging 1.00
R2516:App UTSW 16 84978229 missense probably damaging 0.97
R4366:App UTSW 16 85056433 missense unknown
R4735:App UTSW 16 85103314 missense probably damaging 0.99
R4849:App UTSW 16 85056434 missense unknown
R4851:App UTSW 16 85056434 missense unknown
R6254:App UTSW 16 84978177 missense probably damaging 1.00
R6489:App UTSW 16 85056520 missense unknown
R6796:App UTSW 16 85120567 missense probably damaging 0.98
R7132:App UTSW 16 85056482 missense unknown
R7194:App UTSW 16 85025431 missense probably benign 0.40
R7456:App UTSW 16 85173560
R7528:App UTSW 16 84978258 missense possibly damaging 0.89
R7594:App UTSW 16 85080002 missense unknown
R7699:App UTSW 16 85040309 critical splice acceptor site probably null
R7700:App UTSW 16 85040309 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- ACCAGGGCATGATTCAGCACTTTTC -3'
(R):5'- TCATTCAGCCGAGTCTCTCACAGC -3'

Sequencing Primer
(F):5'- TATAGTCTAGGACTCCTTCAACAGC -3'
(R):5'- AGTGGCTGATGTTGAGGAAG -3'
Posted On2013-06-11