Mutagenetix > Incidental Mutation

Incidental Mutation 'R0440:Chd8'

46710

Institutional Source

Beutler Lab

Gene Symbol

Chd8

Ensembl Gene

ENSMUSG00000053754

Gene Name

chromodomain helicase DNA binding protein 8

Synonyms

Duplin, 5830451P18Rik

MMRRC Submission

038641-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R0440 (G1)

Quality Score

225

Status

Validated (trace)

Chromosome

Chromosomal Location

52198151-52257780 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 52204826 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Serine at position 2096 (T2096S)

Ref Sequence

ENSEMBL: ENSMUSP00000142890 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000089752] [ENSMUST00000149975] [ENSMUST00000200169] [ENSMUST00000227897]

AlphaFold

Q09XV5

Predicted Effect

possibly damaging
Transcript: ENSMUST00000089752
AA Change: T2096S

PolyPhen 2 Score 0.907 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000087184
Gene: ENSMUSG00000053754
AA Change: T2096S

Domain	Start	End	E-Value	Type
low complexity region	255	272	N/A	INTRINSIC
low complexity region	340	374	N/A	INTRINSIC
low complexity region	404	437	N/A	INTRINSIC
low complexity region	463	477	N/A	INTRINSIC
low complexity region	497	534	N/A	INTRINSIC
low complexity region	588	607	N/A	INTRINSIC
CHROMO	642	708	1.8e-9	SMART
CHROMO	724	782	1.55e-4	SMART
DEXDc	809	1011	4.13e-37	SMART
HELICc	1165	1249	1.01e-22	SMART
low complexity region	1335	1345	N/A	INTRINSIC
low complexity region	1422	1441	N/A	INTRINSIC
Blast:DEXDc	1460	1505	4e-16	BLAST
low complexity region	1579	1590	N/A	INTRINSIC
low complexity region	1703	1714	N/A	INTRINSIC
low complexity region	1770	1785	N/A	INTRINSIC
low complexity region	1887	1903	N/A	INTRINSIC
low complexity region	2063	2107	N/A	INTRINSIC
low complexity region	2222	2239	N/A	INTRINSIC
BRK	2312	2356	1.34e-19	SMART
BRK	2381	2421	1.94e-2	SMART
low complexity region	2452	2472	N/A	INTRINSIC
low complexity region	2494	2510	N/A	INTRINSIC
low complexity region	2514	2529	N/A	INTRINSIC
low complexity region	2538	2550	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000134329

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000136528

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000145404

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000147309

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000147827

Predicted Effect

probably benign
Transcript: ENSMUST00000149975
AA Change: T756S

PolyPhen 2 Score 0.023 (Sensitivity: 0.95; Specificity: 0.81)

SMART Domains

Protein: ENSMUSP00000122995
Gene: ENSMUSG00000053754
AA Change: T756S

Domain	Start	End	E-Value	Type
low complexity region	74	93	N/A	INTRINSIC
Blast:DEXDc	112	235	9e-40	BLAST
low complexity region	239	250	N/A	INTRINSIC
low complexity region	363	374	N/A	INTRINSIC
low complexity region	430	445	N/A	INTRINSIC
Blast:SANT	456	515	1e-29	BLAST
low complexity region	547	563	N/A	INTRINSIC
low complexity region	723	767	N/A	INTRINSIC
low complexity region	882	899	N/A	INTRINSIC
BRK	972	1016	1.34e-19	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000175303

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000180857

Predicted Effect

possibly damaging
Transcript: ENSMUST00000200169
AA Change: T2096S

PolyPhen 2 Score 0.907 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000142890
Gene: ENSMUSG00000053754
AA Change: T2096S

Domain	Start	End	E-Value	Type
low complexity region	255	272	N/A	INTRINSIC
low complexity region	340	374	N/A	INTRINSIC
low complexity region	404	437	N/A	INTRINSIC
low complexity region	463	477	N/A	INTRINSIC
low complexity region	497	534	N/A	INTRINSIC
low complexity region	588	607	N/A	INTRINSIC
CHROMO	642	708	1.8e-9	SMART
CHROMO	724	782	1.55e-4	SMART
DEXDc	809	1011	4.13e-37	SMART
HELICc	1165	1249	1.01e-22	SMART
low complexity region	1335	1345	N/A	INTRINSIC
low complexity region	1422	1441	N/A	INTRINSIC
Blast:DEXDc	1460	1505	4e-16	BLAST
low complexity region	1579	1590	N/A	INTRINSIC
low complexity region	1703	1714	N/A	INTRINSIC
low complexity region	1770	1785	N/A	INTRINSIC
low complexity region	1887	1903	N/A	INTRINSIC
low complexity region	2063	2107	N/A	INTRINSIC
low complexity region	2222	2239	N/A	INTRINSIC
BRK	2312	2356	1.34e-19	SMART
BRK	2381	2421	1.94e-2	SMART
low complexity region	2452	2472	N/A	INTRINSIC
low complexity region	2494	2510	N/A	INTRINSIC
low complexity region	2514	2529	N/A	INTRINSIC
low complexity region	2538	2550	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000226681

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000227448

Predicted Effect

probably benign
Transcript: ENSMUST00000227897

Meta Mutation Damage Score

0.0582

Coding Region Coverage

1x: 99.6%
3x: 98.8%
10x: 97.0%
20x: 94.1%

Validation Efficiency

99% (68/69)

MGI Phenotype

FUNCTION: This gene encodes a member of the chromodomain-helicase-DNA binding protein family, which is characterized by a SNF2-like domain and two chromatin organization modifier domains. The encoded protein also contains brahma and kismet domains, which is common to the subfamily of chromodomain-helicase-DNA binding proteins to which this protein belongs. In mammals, this gene has been shown to function in several processes including transcriptional regulation, epigenetic remodeling, promotion of cell proliferation, and regulation of RNA synthesis. Knockout of this gene causes early embryonic lethality due to widespread apoptosis. Heterozygous loss of function mutations result in autism spectrum disorder-like behaviors that include increased anxiety, repetitive behavior, and altered social behavior. [provided by RefSeq, Dec 2016]
PHENOTYPE: Homozygous null embryos are growth retarded starting at E5.5 and exhibit developmental arrest at E6.5. Mutants develop into an egg cylinder but do not form a primitive streak or mesoderm and exhibit increased apoptosis at E7.5. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 67 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A4galt	G	A	15: 83,228,493	R30W	probably damaging	Het
Adam7	T	C	14: 68,510,856		probably null	Het
Agl	A	T	3: 116,758,806	L1158Q	probably damaging	Het
Akap9	T	C	5: 4,064,569	S66P	probably damaging	Het
Akr1c20	T	A	13: 4,487,208	D316V	probably benign	Het
App	C	A	16: 85,056,414	E259*	probably null	Het
Arhgef4	A	G	1: 34,745,448		probably null	Het
Armc9	G	A	1: 86,194,262		probably null	Het
Ass1	A	T	2: 31,514,819	N371Y	probably damaging	Het
Btaf1	C	T	19: 36,986,653	P875S	probably damaging	Het
Cc2d1b	T	A	4: 108,625,816		probably null	Het
Ccar1	C	T	10: 62,780,457	V165I	possibly damaging	Het
Ccdc106	A	T	7: 5,060,245	I250F	probably damaging	Het
Ccny	T	C	18: 9,332,917	I205V	probably benign	Het
Cfap52	T	A	11: 67,954,088	I52L	probably benign	Het
Clstn3	G	A	6: 124,451,413	T423I	probably damaging	Het
Col13a1	T	C	10: 61,867,483	D440G	possibly damaging	Het
Dclk3	G	A	9: 111,469,163	V592M	probably damaging	Het
Ddx31	A	T	2: 28,857,132	I208F	probably damaging	Het
Dlat	A	T	9: 50,645,119		probably null	Het
Eml4	T	C	17: 83,446,058		probably null	Het
Enpp2	T	A	15: 54,847,237		probably benign	Het
Fryl	T	C	5: 73,086,972	S38G	possibly damaging	Het
Gcnt1	G	A	19: 17,330,316	T15I	probably benign	Het
Gm21834	T	C	17: 57,742,126	T32A	possibly damaging	Het
Golga2	A	G	2: 32,302,933	D394G	probably damaging	Het
Gtf3c4	G	T	2: 28,840,169		probably null	Het
Igkv4-69	A	G	6: 69,284,269		probably benign	Het
Inpp5j	T	C	11: 3,501,150	R500G	possibly damaging	Het
Kif5b	A	T	18: 6,226,980		probably benign	Het
Klhl36	A	G	8: 119,876,551	E515G	probably damaging	Het
Lifr	C	T	15: 7,157,191	R59*	probably null	Het
Lrif1	A	T	3: 106,734,398	Q10L	possibly damaging	Het
Lrp8	A	G	4: 107,869,098	E908G	probably damaging	Het
Lrrc23	A	T	6: 124,770,704	D307E	probably benign	Het
Mpv17l	T	C	16: 13,944,719	F27L	probably damaging	Het
Mta3	C	T	17: 83,766,587	A76V	probably damaging	Het
Muc5ac	T	A	7: 141,792,034	Y202*	probably null	Het
Naprt	A	G	15: 75,891,069		probably benign	Het
Npr2	T	A	4: 43,650,315	V960D	probably damaging	Het
Oca2	A	T	7: 56,423,352	Y765F	probably benign	Het
Olfr715	A	T	7: 107,128,732	H220Q	probably benign	Het
Plxna2	T	A	1: 194,644,404	Y215*	probably null	Het
Prdm16	G	A	4: 154,476,627		probably benign	Het
Ptn	A	G	6: 36,744,497	S3P	probably benign	Het
Pus10	T	C	11: 23,673,331		probably benign	Het
Rad21	A	T	15: 51,968,358	D442E	probably benign	Het
Rmdn2	A	G	17: 79,667,955	H291R	probably damaging	Het
Rp1	A	G	1: 4,345,640	S1750P	probably damaging	Het
Samd4b	A	T	7: 28,408,160	I228N	probably benign	Het
Sdr9c7	G	T	10: 127,898,953		probably benign	Het
Slc13a2	T	C	11: 78,403,175	N254D	probably benign	Het
Slc16a8	T	A	15: 79,252,607	I132F	probably damaging	Het
Slc18b1	T	A	10: 23,819,078	Y274N	probably benign	Het
Slc45a2	A	T	15: 11,000,817	M1L	probably benign	Het
Smc1b	A	G	15: 85,112,673		probably benign	Het
Stab2	T	C	10: 86,949,928	S617G	probably benign	Het
Stk10	A	G	11: 32,604,190	M626V	probably damaging	Het
Synpo2l	T	G	14: 20,661,398	I385L	possibly damaging	Het
Tmprss11d	T	C	5: 86,338,812	Y73C	probably damaging	Het
Ttc21b	A	G	2: 66,236,382	V309A	probably benign	Het
Tubgcp6	A	G	15: 89,103,065	I1235T	probably benign	Het
Usp8	A	G	2: 126,725,390	I110V	probably benign	Het
Vps13c	G	A	9: 67,972,861	G3442S	probably damaging	Het
Wdr59	GGGTGGTG	GGGTG	8: 111,480,540		probably benign	Het
Zfp207	T	A	11: 80,395,507		probably benign	Het
Zfp748	A	C	13: 67,553,025		probably null	Het

Other mutations in Chd8

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00572:Chd8	APN	14	52226138	missense	probably damaging	0.99
IGL00694:Chd8	APN	14	52217970	missense	probably damaging	1.00
IGL01011:Chd8	APN	14	52231532	missense	possibly damaging	0.86
IGL01022:Chd8	APN	14	52236993	missense	probably benign
IGL01066:Chd8	APN	14	52217766	missense	probably damaging	1.00
IGL01083:Chd8	APN	14	52221420	missense	probably damaging	1.00
IGL01313:Chd8	APN	14	52210575	missense	probably damaging	1.00
IGL01396:Chd8	APN	14	52204587	unclassified	probably benign
IGL01476:Chd8	APN	14	52205490	missense	probably benign	0.32
IGL01731:Chd8	APN	14	52212654	missense	probably benign	0.12
IGL01895:Chd8	APN	14	52199094	missense	probably benign	0.00
IGL02090:Chd8	APN	14	52227234	critical splice donor site	probably null
IGL02344:Chd8	APN	14	52201650	missense	probably damaging	1.00
IGL02573:Chd8	APN	14	52219734	missense	possibly damaging	0.95
IGL02601:Chd8	APN	14	52214300	missense	possibly damaging	0.94
IGL02617:Chd8	APN	14	52235191	missense	probably benign	0.34
IGL02873:Chd8	APN	14	52222513	missense	probably damaging	0.99
IGL02974:Chd8	APN	14	52201701	splice site	probably null
IGL03058:Chd8	APN	14	52218273	missense	probably damaging	1.00
IGL03076:Chd8	APN	14	52226162	splice site	probably benign
IGL03239:Chd8	APN	14	52227548	missense	possibly damaging	0.92
PIT4431001:Chd8	UTSW	14	52218249	missense	probably damaging	0.98
PIT4468001:Chd8	UTSW	14	52207996	missense	probably benign
PIT4468001:Chd8	UTSW	14	52217881	missense	possibly damaging	0.95
R0006:Chd8	UTSW	14	52235293	missense	possibly damaging	0.51
R0006:Chd8	UTSW	14	52235293	missense	possibly damaging	0.51
R0022:Chd8	UTSW	14	52232855	missense	probably benign	0.00
R0115:Chd8	UTSW	14	52237206	missense	probably benign	0.00
R0131:Chd8	UTSW	14	52205326	missense	probably benign	0.15
R0131:Chd8	UTSW	14	52205326	missense	probably benign	0.15
R0132:Chd8	UTSW	14	52205326	missense	probably benign	0.15
R0419:Chd8	UTSW	14	52204060	missense	probably benign	0.24
R0452:Chd8	UTSW	14	52214587	missense	probably damaging	1.00
R0481:Chd8	UTSW	14	52237206	missense	probably benign	0.00
R0624:Chd8	UTSW	14	52219757	missense	possibly damaging	0.65
R0650:Chd8	UTSW	14	52202304	missense	probably benign	0.09
R0691:Chd8	UTSW	14	52213433	missense	probably damaging	0.96
R0790:Chd8	UTSW	14	52204025	missense	probably benign	0.07
R0835:Chd8	UTSW	14	52204025	missense	probably benign	0.07
R1180:Chd8	UTSW	14	52221108	missense	probably damaging	1.00
R1411:Chd8	UTSW	14	52224646	missense	probably benign
R1725:Chd8	UTSW	14	52232573	missense	probably benign	0.08
R1838:Chd8	UTSW	14	52204883	missense	probably benign	0.11
R1839:Chd8	UTSW	14	52204883	missense	probably benign	0.11
R1968:Chd8	UTSW	14	52220993	missense	probably damaging	0.98
R2020:Chd8	UTSW	14	52215241	missense	probably damaging	1.00
R2024:Chd8	UTSW	14	52231493	missense	probably benign	0.23
R2139:Chd8	UTSW	14	52236971	missense	probably benign	0.32
R2163:Chd8	UTSW	14	52198818	missense	possibly damaging	0.53
R2342:Chd8	UTSW	14	52205217	missense	probably benign	0.25
R2844:Chd8	UTSW	14	52204495	missense	possibly damaging	0.92
R3500:Chd8	UTSW	14	52205653	missense	probably benign	0.00
R3861:Chd8	UTSW	14	52237121	missense	probably benign	0.13
R4154:Chd8	UTSW	14	52207211	unclassified	probably benign
R4445:Chd8	UTSW	14	52204527	splice site	probably null
R4628:Chd8	UTSW	14	52206915	missense	probably benign	0.03
R4779:Chd8	UTSW	14	52231506	missense	probably damaging	1.00
R4783:Chd8	UTSW	14	52205368	missense	probably damaging	1.00
R4784:Chd8	UTSW	14	52205368	missense	probably damaging	1.00
R5001:Chd8	UTSW	14	52203915	missense	probably benign	0.09
R5280:Chd8	UTSW	14	52205125	missense	possibly damaging	0.68
R5331:Chd8	UTSW	14	52202114	intron	probably benign
R5348:Chd8	UTSW	14	52232698	missense	probably damaging	1.00
R5375:Chd8	UTSW	14	52204154	missense	probably damaging	1.00
R5470:Chd8	UTSW	14	52212609	missense	probably damaging	1.00
R5479:Chd8	UTSW	14	52215195	missense	probably benign	0.15
R5488:Chd8	UTSW	14	52213048	intron	probably benign
R5489:Chd8	UTSW	14	52213048	intron	probably benign
R5499:Chd8	UTSW	14	52204431	critical splice donor site	probably null
R5988:Chd8	UTSW	14	52217938	missense	probably damaging	1.00
R6046:Chd8	UTSW	14	52221071	missense	possibly damaging	0.60
R6125:Chd8	UTSW	14	52207034	missense	probably benign	0.16
R6212:Chd8	UTSW	14	52201698	missense	probably damaging	1.00
R6337:Chd8	UTSW	14	52204109	missense	probably damaging	1.00
R6394:Chd8	UTSW	14	52202585	missense	possibly damaging	0.66
R6576:Chd8	UTSW	14	52216076	missense	probably damaging	1.00
R6590:Chd8	UTSW	14	52227237	missense	possibly damaging	0.60
R6690:Chd8	UTSW	14	52227237	missense	possibly damaging	0.60
R6786:Chd8	UTSW	14	52226668	missense	probably benign	0.33
R6913:Chd8	UTSW	14	52214494	missense	probably damaging	0.99
R7090:Chd8	UTSW	14	52215220	missense	probably damaging	0.99
R7107:Chd8	UTSW	14	52212672	missense	probably benign	0.07
R7138:Chd8	UTSW	14	52214498	missense	possibly damaging	0.83
R7383:Chd8	UTSW	14	52215319	missense	probably damaging	1.00
R7392:Chd8	UTSW	14	52232855	missense	probably benign
R7471:Chd8	UTSW	14	52204112	missense	probably benign
R7625:Chd8	UTSW	14	52237077	missense	probably benign	0.04
R7790:Chd8	UTSW	14	52226082	missense	probably damaging	1.00
R7862:Chd8	UTSW	14	52214277	missense	probably damaging	1.00
R7937:Chd8	UTSW	14	52227506	missense	probably benign	0.02
R8092:Chd8	UTSW	14	52217727	missense	probably damaging	1.00
R8237:Chd8	UTSW	14	52213352	missense	probably damaging	1.00
R8321:Chd8	UTSW	14	52232567	missense	probably benign	0.01
R8371:Chd8	UTSW	14	52232818	missense	probably benign
R8425:Chd8	UTSW	14	52210555	missense	probably damaging	1.00
R8674:Chd8	UTSW	14	52213006	missense	probably damaging	0.98
R8794:Chd8	UTSW	14	52204447	missense	probably damaging	0.98
R8828:Chd8	UTSW	14	52210580	frame shift	probably null
R8909:Chd8	UTSW	14	52212932	missense	possibly damaging	0.82
R9194:Chd8	UTSW	14	52202193	missense	probably benign	0.01
R9278:Chd8	UTSW	14	52235170	missense	probably benign	0.01
R9489:Chd8	UTSW	14	52219598	missense	probably damaging	0.98
R9501:Chd8	UTSW	14	52214588	missense	probably benign	0.04
R9546:Chd8	UTSW	14	52215951	missense	probably damaging	1.00
R9605:Chd8	UTSW	14	52219598	missense	probably damaging	0.98
R9694:Chd8	UTSW	14	52203884	missense	possibly damaging	0.86

Predicted Primers

PCR Primer
(F):5'- CGGTCAGCAGCTAGAAATCACACAG -3'
(R):5'- GCGTAGGCTCTTCAGATACAGCTC -3'

Sequencing Primer
(F):5'- ATCACACAGCATTTGTGGGC -3'
(R):5'- AGATACAGCTCCTCTGTCCCG -3'

Posted On

2013-06-11