Incidental Mutation 'R0440:Stk10'
ID46704
Institutional Source Beutler Lab
Gene Symbol Stk10
Ensembl Gene ENSMUSG00000020272
Gene Nameserine/threonine kinase 10
SynonymsGek1, Lok
MMRRC Submission 038641-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.138) question?
Stock #R0440 (G1)
Quality Score176
Status Validated (trace)
Chromosome11
Chromosomal Location32533305-32624587 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 32604190 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Valine at position 626 (M626V)
Ref Sequence ENSEMBL: ENSMUSP00000099885 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102821]
Predicted Effect probably damaging
Transcript: ENSMUST00000102821
AA Change: M626V

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000099885
Gene: ENSMUSG00000020272
AA Change: M626V

DomainStartEndE-ValueType
S_TKc 36 294 8.66e-92 SMART
low complexity region 316 334 N/A INTRINSIC
low complexity region 544 577 N/A INTRINSIC
Pfam:PKK 586 724 1.9e-41 PFAM
Pfam:PKK 754 894 2.2e-37 PFAM
Meta Mutation Damage Score 0.1333 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.8%
  • 10x: 97.0%
  • 20x: 94.1%
Validation Efficiency 99% (68/69)
MGI Phenotype FUNCTION: This gene encodes a member of the Ste20 family of serine/threonine protein kinases, and is similar to several known polo-like kinase kinases. Mice deficient for this gene product are viable, but exhibit altered integrin-mediated lymphocyte adhesion characteristics. The orthologous gene product in humans can associate with and phosphorylate polo-like kinase 1, and overexpression of a kinase-dead version of the protein interferes with normal cell cycle progression. [provided by RefSeq, Jul 2008]
PHENOTYPE: Targeted disruption of this gene results in enhanced cell adhesion in mitogen-stimulated T cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A4galt G A 15: 83,228,493 R30W probably damaging Het
Adam7 T C 14: 68,510,856 probably null Het
Agl A T 3: 116,758,806 L1158Q probably damaging Het
Akap9 T C 5: 4,064,569 S66P probably damaging Het
Akr1c20 T A 13: 4,487,208 D316V probably benign Het
App C A 16: 85,056,414 E259* probably null Het
Arhgef4 A G 1: 34,745,448 probably null Het
Armc9 G A 1: 86,194,262 probably null Het
Ass1 A T 2: 31,514,819 N371Y probably damaging Het
Btaf1 C T 19: 36,986,653 P875S probably damaging Het
Cc2d1b T A 4: 108,625,816 probably null Het
Ccar1 C T 10: 62,780,457 V165I possibly damaging Het
Ccdc106 A T 7: 5,060,245 I250F probably damaging Het
Ccny T C 18: 9,332,917 I205V probably benign Het
Cfap52 T A 11: 67,954,088 I52L probably benign Het
Chd8 T A 14: 52,204,826 T2096S possibly damaging Het
Clstn3 G A 6: 124,451,413 T423I probably damaging Het
Col13a1 T C 10: 61,867,483 D440G possibly damaging Het
Dclk3 G A 9: 111,469,163 V592M probably damaging Het
Ddx31 A T 2: 28,857,132 I208F probably damaging Het
Dlat A T 9: 50,645,119 probably null Het
Eml4 T C 17: 83,446,058 probably null Het
Enpp2 T A 15: 54,847,237 probably benign Het
Fryl T C 5: 73,086,972 S38G possibly damaging Het
Gcnt1 G A 19: 17,330,316 T15I probably benign Het
Gm21834 T C 17: 57,742,126 T32A possibly damaging Het
Golga2 A G 2: 32,302,933 D394G probably damaging Het
Gtf3c4 G T 2: 28,840,169 probably null Het
Igkv4-69 A G 6: 69,284,269 probably benign Het
Inpp5j T C 11: 3,501,150 R500G possibly damaging Het
Kif5b A T 18: 6,226,980 probably benign Het
Klhl36 A G 8: 119,876,551 E515G probably damaging Het
Lifr C T 15: 7,157,191 R59* probably null Het
Lrif1 A T 3: 106,734,398 Q10L possibly damaging Het
Lrp8 A G 4: 107,869,098 E908G probably damaging Het
Lrrc23 A T 6: 124,770,704 D307E probably benign Het
Mpv17l T C 16: 13,944,719 F27L probably damaging Het
Mta3 C T 17: 83,766,587 A76V probably damaging Het
Muc5ac T A 7: 141,792,034 Y202* probably null Het
Naprt A G 15: 75,891,069 probably benign Het
Npr2 T A 4: 43,650,315 V960D probably damaging Het
Oca2 A T 7: 56,423,352 Y765F probably benign Het
Olfr715 A T 7: 107,128,732 H220Q probably benign Het
Plxna2 T A 1: 194,644,404 Y215* probably null Het
Prdm16 G A 4: 154,476,627 probably benign Het
Ptn A G 6: 36,744,497 S3P probably benign Het
Pus10 T C 11: 23,673,331 probably benign Het
Rad21 A T 15: 51,968,358 D442E probably benign Het
Rmdn2 A G 17: 79,667,955 H291R probably damaging Het
Rp1 A G 1: 4,345,640 S1750P probably damaging Het
Samd4b A T 7: 28,408,160 I228N probably benign Het
Sdr9c7 G T 10: 127,898,953 probably benign Het
Slc13a2 T C 11: 78,403,175 N254D probably benign Het
Slc16a8 T A 15: 79,252,607 I132F probably damaging Het
Slc18b1 T A 10: 23,819,078 Y274N probably benign Het
Slc45a2 A T 15: 11,000,817 M1L probably benign Het
Smc1b A G 15: 85,112,673 probably benign Het
Stab2 T C 10: 86,949,928 S617G probably benign Het
Synpo2l T G 14: 20,661,398 I385L possibly damaging Het
Tmprss11d T C 5: 86,338,812 Y73C probably damaging Het
Ttc21b A G 2: 66,236,382 V309A probably benign Het
Tubgcp6 A G 15: 89,103,065 I1235T probably benign Het
Usp8 A G 2: 126,725,390 I110V probably benign Het
Vps13c G A 9: 67,972,861 G3442S probably damaging Het
Wdr59 GGGTGGTG GGGTG 8: 111,480,540 probably benign Het
Zfp207 T A 11: 80,395,507 probably benign Het
Zfp748 A C 13: 67,553,025 probably null Het
Other mutations in Stk10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01105:Stk10 APN 11 32577740 missense probably benign 0.33
IGL01285:Stk10 APN 11 32610653 missense possibly damaging 0.91
IGL01983:Stk10 APN 11 32589460 missense probably benign 0.05
IGL03177:Stk10 APN 11 32614592 missense probably damaging 1.00
IGL03183:Stk10 APN 11 32604143 missense possibly damaging 0.50
coquet UTSW 11 32577764 missense
legacy UTSW 11 32604166 nonsense probably null
mignon UTSW 11 32587363 missense probably damaging 1.00
FR4976:Stk10 UTSW 11 32614520 critical splice acceptor site probably benign
R0003:Stk10 UTSW 11 32589460 missense probably benign 0.05
R0008:Stk10 UTSW 11 32587305 splice site probably benign
R0056:Stk10 UTSW 11 32617851 missense possibly damaging 0.95
R0076:Stk10 UTSW 11 32603722 missense probably benign
R0227:Stk10 UTSW 11 32617859 missense probably damaging 1.00
R0454:Stk10 UTSW 11 32596724 missense probably damaging 0.99
R0481:Stk10 UTSW 11 32614708 missense probably damaging 1.00
R0504:Stk10 UTSW 11 32617882 missense probably benign 0.04
R0790:Stk10 UTSW 11 32598653 missense probably benign 0.00
R1439:Stk10 UTSW 11 32617919 missense probably damaging 0.98
R1539:Stk10 UTSW 11 32533440 missense possibly damaging 0.85
R1770:Stk10 UTSW 11 32622464 missense possibly damaging 0.94
R4304:Stk10 UTSW 11 32610634 missense probably damaging 0.97
R4430:Stk10 UTSW 11 32533552 missense possibly damaging 0.81
R4702:Stk10 UTSW 11 32555172 missense probably benign 0.28
R4797:Stk10 UTSW 11 32598471 missense probably benign 0.01
R5447:Stk10 UTSW 11 32604166 nonsense probably null
R5801:Stk10 UTSW 11 32596748 missense probably benign 0.01
R5802:Stk10 UTSW 11 32596748 missense probably benign 0.01
R6129:Stk10 UTSW 11 32615871 missense probably damaging 1.00
R6154:Stk10 UTSW 11 32603654 splice site probably null
R6175:Stk10 UTSW 11 32603761 missense possibly damaging 0.46
R6185:Stk10 UTSW 11 32577749 missense probably benign 0.13
R6520:Stk10 UTSW 11 32588839 missense probably damaging 1.00
R6824:Stk10 UTSW 11 32587363 missense probably damaging 1.00
R7259:Stk10 UTSW 11 32598497 missense probably benign 0.00
R7649:Stk10 UTSW 11 32577764 missense
R8331:Stk10 UTSW 11 32588928 missense
X0027:Stk10 UTSW 11 32587361 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AGAGGAAATCCCCTGTGTGGAGTG -3'
(R):5'- ACAAGTGTCATAGCTTTGTGGCTGG -3'

Sequencing Primer
(F):5'- tgagacacacagcaaaggg -3'
(R):5'- gaccctaaaagagaaaagactatcac -3'
Posted On2013-06-11