Incidental Mutation 'R5450:Olfr1269'
ID478319
Institutional Source Beutler Lab
Gene Symbol Olfr1269
Ensembl Gene ENSMUSG00000084336
Gene Nameolfactory receptor 1269
SynonymsGA_x6K02T2Q125-51551618-51550689, MOR228-3
MMRRC Submission 043015-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.239) question?
Stock #R5450 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location90116187-90121412 bp(-) (GRCm38)
Type of Mutationmakesense
DNA Base Change (assembly) A to G at 90118669 bp
ZygosityHeterozygous
Amino Acid Change Stop codon to Glutamine at position 310 (*310Q)
Ref Sequence ENSEMBL: ENSMUSP00000150470 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099756] [ENSMUST00000117787] [ENSMUST00000214404] [ENSMUST00000216493]
Predicted Effect probably null
Transcript: ENSMUST00000099756
AA Change: *310Q
SMART Domains Protein: ENSMUSP00000097345
Gene: ENSMUSG00000084336
AA Change: *310Q

DomainStartEndE-ValueType
Pfam:7tm_4 29 303 3.8e-50 PFAM
Pfam:7TM_GPCR_Srsx 33 300 1.2e-5 PFAM
Pfam:7tm_1 39 285 5.9e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000117787
Predicted Effect probably null
Transcript: ENSMUST00000214404
AA Change: *310Q
Predicted Effect probably null
Transcript: ENSMUST00000216493
AA Change: *310Q
Meta Mutation Damage Score 0.8314 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency 97% (74/76)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930505A04Rik C T 11: 30,426,349 V173M probably damaging Het
AF067063 A T 13: 119,828,363 V99E probably damaging Het
Arhgef4 T G 1: 34,807,324 probably benign Het
Atg14 T C 14: 47,551,464 N144S probably benign Het
Cacna1h A T 17: 25,383,186 M1454K probably damaging Het
Catsperb A T 12: 101,446,068 H138L possibly damaging Het
Ccdc129 T A 6: 55,968,811 probably null Het
Cd200r2 T A 16: 44,909,571 D159E probably benign Het
Cd79a G T 7: 24,899,262 G79C probably damaging Het
Ceacam20 A G 7: 19,978,208 H38R possibly damaging Het
Cers1 T C 8: 70,318,297 L119P probably damaging Het
Ces1f C A 8: 93,265,795 V343L probably benign Het
Ces3a G A 8: 105,057,918 G511S possibly damaging Het
Cyfip2 A G 11: 46,284,252 C98R probably benign Het
Cyp2j11 C A 4: 96,339,876 V169L probably benign Het
Cyp4f17 A G 17: 32,528,886 T523A probably benign Het
Ddx31 T C 2: 28,886,969 S567P probably damaging Het
Dnase1l1 C T X: 74,277,038 probably null Het
Dsg1b A C 18: 20,409,064 H876P probably damaging Het
Edrf1 G T 7: 133,658,610 M83I probably damaging Het
Eno4 T C 19: 58,960,247 F393S possibly damaging Het
Eral1 C T 11: 78,078,357 D106N probably benign Het
Esp18 G T 17: 39,408,179 R23M probably benign Het
Fam184b C T 5: 45,539,801 V674I probably benign Het
Fbxw13 A C 9: 109,184,157 N154K probably benign Het
Gtpbp6 A G 5: 110,107,125 V130A probably damaging Het
Hc T C 2: 35,013,038 D1067G possibly damaging Het
Ighg1 A T 12: 113,330,506 S6T unknown Het
Ikzf3 C T 11: 98,467,086 R475H probably damaging Het
Kcmf1 A T 6: 72,842,930 L311* probably null Het
Kmt2d C A 15: 98,855,086 E184D probably damaging Het
Lrguk A T 6: 34,071,061 I314F probably damaging Het
Maml2 A C 9: 13,706,467 S370R probably damaging Het
Mroh1 C A 15: 76,432,347 probably benign Het
Mx1 A T 16: 97,454,147 Y235* probably null Het
Pamr1 T G 2: 102,639,317 Y403D probably damaging Het
Panx2 A G 15: 89,068,959 E551G possibly damaging Het
Patl2 A G 2: 122,125,281 V258A probably benign Het
Ppm1m A G 9: 106,196,842 F255L probably benign Het
Prpf40a G T 2: 53,156,926 T266N possibly damaging Het
Psg18 T A 7: 18,353,425 I103F probably benign Het
Rpl39-ps A G 15: 102,635,148 noncoding transcript Het
Rps6kb1 A T 11: 86,532,837 F106I probably damaging Het
Rsf1 CG CGACGGCGGTG 7: 97,579,908 probably benign Het
Sardh G T 2: 27,239,698 T245K possibly damaging Het
Shprh T G 10: 11,212,330 I1619S possibly damaging Het
Skint1 G A 4: 112,025,532 V258I probably benign Het
Slc27a5 T C 7: 12,994,942 D331G probably benign Het
Slc29a2 A G 19: 5,029,275 I309V probably benign Het
Slc30a5 C T 13: 100,821,172 V130I possibly damaging Het
Slc4a3 C A 1: 75,552,656 A531D probably damaging Het
Slc6a16 C T 7: 45,261,248 T399I probably benign Het
Slitrk6 T A 14: 110,750,097 H726L probably benign Het
Snx2 A G 18: 53,210,712 K309R probably damaging Het
Speer4f2 T A 5: 17,373,219 C4S possibly damaging Het
Sulf1 T C 1: 12,796,907 V105A probably benign Het
Tmem8b G A 4: 43,673,992 V208I probably benign Het
Vmn1r47 T C 6: 90,022,213 L109P probably damaging Het
Vmn1r73 C A 7: 11,756,449 Q65K possibly damaging Het
Vmn1r76 T C 7: 11,930,684 Y166C probably damaging Het
Vmn2r2 T C 3: 64,126,590 T504A probably benign Het
Wdr75 C A 1: 45,812,164 A300E probably benign Het
Yars A G 4: 129,197,246 E149G possibly damaging Het
Zbtb18 T C 1: 177,447,205 F35L probably damaging Het
Zfp366 A G 13: 99,229,585 Y418C probably damaging Het
Other mutations in Olfr1269
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01389:Olfr1269 APN 2 90119068 missense probably damaging 1.00
IGL01518:Olfr1269 APN 2 90118971 missense possibly damaging 0.95
IGL01889:Olfr1269 APN 2 90118965 missense possibly damaging 0.84
IGL02629:Olfr1269 APN 2 90118857 nonsense probably null
R0732:Olfr1269 UTSW 2 90119322 missense probably benign 0.20
R1446:Olfr1269 UTSW 2 90118858 missense probably damaging 0.98
R1938:Olfr1269 UTSW 2 90119083 missense probably damaging 0.97
R4526:Olfr1269 UTSW 2 90118672 missense probably benign 0.01
R4786:Olfr1269 UTSW 2 90119007 missense possibly damaging 0.95
R4792:Olfr1269 UTSW 2 90118830 missense possibly damaging 0.95
R4925:Olfr1269 UTSW 2 90118777 missense probably damaging 1.00
R5152:Olfr1269 UTSW 2 90119121 missense probably damaging 0.98
R5296:Olfr1269 UTSW 2 90118699 missense probably damaging 0.97
R5536:Olfr1269 UTSW 2 90118839 missense probably benign 0.00
R7572:Olfr1269 UTSW 2 90118743 missense probably damaging 1.00
R7695:Olfr1269 UTSW 2 90118863 missense probably benign 0.08
R7879:Olfr1269 UTSW 2 90118841 nonsense probably null
R7938:Olfr1269 UTSW 2 90118829 nonsense probably null
R8280:Olfr1269 UTSW 2 90119398 missense probably benign 0.27
Predicted Primers PCR Primer
(F):5'- CTATCAGGAGTGCATTTGTAAGAC -3'
(R):5'- GTCCATGTGTCTTCATCTATTTGAG -3'

Sequencing Primer
(F):5'- TTCTGCTGTAAATACTTGCTACAG -3'
(R):5'- AGGCCTTCTGATACCCTACCTGTAG -3'
Posted On2017-06-23