Mutagenetix > Incidental Mutations

Incidental Mutation 'R5450:Olfr1269'

478319

Institutional Source

Beutler Lab

Gene Symbol

Olfr1269

Ensembl Gene

ENSMUSG00000084336

Gene Name

olfactory receptor 1269

Synonyms

GA_x6K02T2Q125-51551618-51550689, MOR228-3

MMRRC Submission

043015-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.239) question?

Stock #

R5450 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

90116187-90121412 bp(-) (GRCm38)

Type of Mutation

makesense

DNA Base Change (assembly)

A to G at 90118669 bp

Zygosity

Heterozygous

Amino Acid Change

Stop codon to Glutamine at position 310 (*310Q)

Ref Sequence

ENSEMBL: ENSMUSP00000150470 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000099756] [ENSMUST00000117787] [ENSMUST00000214404] [ENSMUST00000216493]

Predicted Effect

probably null
Transcript: ENSMUST00000099756
AA Change: *310Q

SMART Domains

Protein: ENSMUSP00000097345
Gene: ENSMUSG00000084336
AA Change: *310Q

Domain	Start	End	E-Value	Type
Pfam:7tm_4	29	303	3.8e-50	PFAM
Pfam:7TM_GPCR_Srsx	33	300	1.2e-5	PFAM
Pfam:7tm_1	39	285	5.9e-20	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000117787

Predicted Effect

probably null
Transcript: ENSMUST00000214404
AA Change: *310Q

Predicted Effect

probably null
Transcript: ENSMUST00000216493
AA Change: *310Q

Meta Mutation Damage Score

0.8314

Coding Region Coverage

1x: 99.3%
3x: 98.6%
10x: 97.2%
20x: 95.2%

Validation Efficiency

97% (74/76)

MGI Phenotype

FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 65 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930505A04Rik	C	T	11: 30,426,349	V173M	probably damaging	Het
AF067063	A	T	13: 119,828,363	V99E	probably damaging	Het
Arhgef4	T	G	1: 34,807,324		probably benign	Het
Atg14	T	C	14: 47,551,464	N144S	probably benign	Het
Cacna1h	A	T	17: 25,383,186	M1454K	probably damaging	Het
Catsperb	A	T	12: 101,446,068	H138L	possibly damaging	Het
Ccdc129	T	A	6: 55,968,811		probably null	Het
Cd200r2	T	A	16: 44,909,571	D159E	probably benign	Het
Cd79a	G	T	7: 24,899,262	G79C	probably damaging	Het
Ceacam20	A	G	7: 19,978,208	H38R	possibly damaging	Het
Cers1	T	C	8: 70,318,297	L119P	probably damaging	Het
Ces1f	C	A	8: 93,265,795	V343L	probably benign	Het
Ces3a	G	A	8: 105,057,918	G511S	possibly damaging	Het
Cyfip2	A	G	11: 46,284,252	C98R	probably benign	Het
Cyp2j11	C	A	4: 96,339,876	V169L	probably benign	Het
Cyp4f17	A	G	17: 32,528,886	T523A	probably benign	Het
Ddx31	T	C	2: 28,886,969	S567P	probably damaging	Het
Dnase1l1	C	T	X: 74,277,038		probably null	Het
Dsg1b	A	C	18: 20,409,064	H876P	probably damaging	Het
Edrf1	G	T	7: 133,658,610	M83I	probably damaging	Het
Eno4	T	C	19: 58,960,247	F393S	possibly damaging	Het
Eral1	C	T	11: 78,078,357	D106N	probably benign	Het
Esp18	G	T	17: 39,408,179	R23M	probably benign	Het
Fam184b	C	T	5: 45,539,801	V674I	probably benign	Het
Fbxw13	A	C	9: 109,184,157	N154K	probably benign	Het
Gtpbp6	A	G	5: 110,107,125	V130A	probably damaging	Het
Hc	T	C	2: 35,013,038	D1067G	possibly damaging	Het
Ighg1	A	T	12: 113,330,506	S6T	unknown	Het
Ikzf3	C	T	11: 98,467,086	R475H	probably damaging	Het
Kcmf1	A	T	6: 72,842,930	L311*	probably null	Het
Kmt2d	C	A	15: 98,855,086	E184D	probably damaging	Het
Lrguk	A	T	6: 34,071,061	I314F	probably damaging	Het
Maml2	A	C	9: 13,706,467	S370R	probably damaging	Het
Mroh1	C	A	15: 76,432,347		probably benign	Het
Mx1	A	T	16: 97,454,147	Y235*	probably null	Het
Pamr1	T	G	2: 102,639,317	Y403D	probably damaging	Het
Panx2	A	G	15: 89,068,959	E551G	possibly damaging	Het
Patl2	A	G	2: 122,125,281	V258A	probably benign	Het
Ppm1m	A	G	9: 106,196,842	F255L	probably benign	Het
Prpf40a	G	T	2: 53,156,926	T266N	possibly damaging	Het
Psg18	T	A	7: 18,353,425	I103F	probably benign	Het
Rpl39-ps	A	G	15: 102,635,148		noncoding transcript	Het
Rps6kb1	A	T	11: 86,532,837	F106I	probably damaging	Het
Rsf1	CG	CGACGGCGGTG	7: 97,579,908		probably benign	Het
Sardh	G	T	2: 27,239,698	T245K	possibly damaging	Het
Shprh	T	G	10: 11,212,330	I1619S	possibly damaging	Het
Skint1	G	A	4: 112,025,532	V258I	probably benign	Het
Slc27a5	T	C	7: 12,994,942	D331G	probably benign	Het
Slc29a2	A	G	19: 5,029,275	I309V	probably benign	Het
Slc30a5	C	T	13: 100,821,172	V130I	possibly damaging	Het
Slc4a3	C	A	1: 75,552,656	A531D	probably damaging	Het
Slc6a16	C	T	7: 45,261,248	T399I	probably benign	Het
Slitrk6	T	A	14: 110,750,097	H726L	probably benign	Het
Snx2	A	G	18: 53,210,712	K309R	probably damaging	Het
Speer4f2	T	A	5: 17,373,219	C4S	possibly damaging	Het
Sulf1	T	C	1: 12,796,907	V105A	probably benign	Het
Tmem8b	G	A	4: 43,673,992	V208I	probably benign	Het
Vmn1r47	T	C	6: 90,022,213	L109P	probably damaging	Het
Vmn1r73	C	A	7: 11,756,449	Q65K	possibly damaging	Het
Vmn1r76	T	C	7: 11,930,684	Y166C	probably damaging	Het
Vmn2r2	T	C	3: 64,126,590	T504A	probably benign	Het
Wdr75	C	A	1: 45,812,164	A300E	probably benign	Het
Yars	A	G	4: 129,197,246	E149G	possibly damaging	Het
Zbtb18	T	C	1: 177,447,205	F35L	probably damaging	Het
Zfp366	A	G	13: 99,229,585	Y418C	probably damaging	Het

Other mutations in Olfr1269

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01389:Olfr1269	APN	2	90119068	missense	probably damaging	1.00
IGL01518:Olfr1269	APN	2	90118971	missense	possibly damaging	0.95
IGL01889:Olfr1269	APN	2	90118965	missense	possibly damaging	0.84
IGL02629:Olfr1269	APN	2	90118857	nonsense	probably null
R0732:Olfr1269	UTSW	2	90119322	missense	probably benign	0.20
R1446:Olfr1269	UTSW	2	90118858	missense	probably damaging	0.98
R1938:Olfr1269	UTSW	2	90119083	missense	probably damaging	0.97
R4526:Olfr1269	UTSW	2	90118672	missense	probably benign	0.01
R4786:Olfr1269	UTSW	2	90119007	missense	possibly damaging	0.95
R4792:Olfr1269	UTSW	2	90118830	missense	possibly damaging	0.95
R4925:Olfr1269	UTSW	2	90118777	missense	probably damaging	1.00
R5152:Olfr1269	UTSW	2	90119121	missense	probably damaging	0.98
R5296:Olfr1269	UTSW	2	90118699	missense	probably damaging	0.97
R5536:Olfr1269	UTSW	2	90118839	missense	probably benign	0.00
R7572:Olfr1269	UTSW	2	90118743	missense	probably damaging	1.00
R7695:Olfr1269	UTSW	2	90118863	missense	probably benign	0.08
R7879:Olfr1269	UTSW	2	90118841	nonsense	probably null
R7938:Olfr1269	UTSW	2	90118829	nonsense	probably null
R8280:Olfr1269	UTSW	2	90119398	missense	probably benign	0.27

Predicted Primers

PCR Primer
(F):5'- CTATCAGGAGTGCATTTGTAAGAC -3'
(R):5'- GTCCATGTGTCTTCATCTATTTGAG -3'

Sequencing Primer
(F):5'- TTCTGCTGTAAATACTTGCTACAG -3'
(R):5'- AGGCCTTCTGATACCCTACCTGTAG -3'

Posted On

2017-06-23