Mutagenetix > Incidental Mutation

Incidental Mutation 'R5450:Atg14'

429300

Institutional Source

Beutler Lab

Gene Symbol

Atg14

Ensembl Gene

ENSMUSG00000037526

Gene Name

autophagy related 14

Synonyms

Barkor, D14Ertd436e, D14Ertd114e

MMRRC Submission

043015-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.870) question?

Stock #

R5450 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

47540893-47570649 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 47551464 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Serine at position 144 (N144S)

Ref Sequence

ENSEMBL: ENSMUSP00000153718 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000042988] [ENSMUST00000226299]

AlphaFold

Q8CDJ3

Predicted Effect

probably benign
Transcript: ENSMUST00000042988
AA Change: N144S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000039047
Gene: ENSMUSG00000037526
AA Change: N144S

Domain	Start	End	E-Value	Type
Pfam:Atg14	43	393	1.1e-79	PFAM
low complexity region	447	464	N/A	INTRINSIC
low complexity region	465	480	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000226299
AA Change: N144S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.3%
3x: 98.6%
10x: 97.2%
20x: 95.2%

Validation Efficiency

97% (74/76)

MGI Phenotype

PHENOTYPE: Mice homozygous for a conditional allele following delivery of a Tat-cre exhibit increased mucin accumulation in colonic epithelial spheroids. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 65 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930505A04Rik	C	T	11: 30,426,349	V173M	probably damaging	Het
AF067063	A	T	13: 119,828,363	V99E	probably damaging	Het
Arhgef4	T	G	1: 34,807,324		probably benign	Het
Cacna1h	A	T	17: 25,383,186	M1454K	probably damaging	Het
Catsperb	A	T	12: 101,446,068	H138L	possibly damaging	Het
Ccdc129	T	A	6: 55,968,811		probably null	Het
Cd200r2	T	A	16: 44,909,571	D159E	probably benign	Het
Cd79a	G	T	7: 24,899,262	G79C	probably damaging	Het
Ceacam20	A	G	7: 19,978,208	H38R	possibly damaging	Het
Cers1	T	C	8: 70,318,297	L119P	probably damaging	Het
Ces1f	C	A	8: 93,265,795	V343L	probably benign	Het
Ces3a	G	A	8: 105,057,918	G511S	possibly damaging	Het
Cyfip2	A	G	11: 46,284,252	C98R	probably benign	Het
Cyp2j11	C	A	4: 96,339,876	V169L	probably benign	Het
Cyp4f17	A	G	17: 32,528,886	T523A	probably benign	Het
Ddx31	T	C	2: 28,886,969	S567P	probably damaging	Het
Dnase1l1	C	T	X: 74,277,038		probably null	Het
Dsg1b	A	C	18: 20,409,064	H876P	probably damaging	Het
Edrf1	G	T	7: 133,658,610	M83I	probably damaging	Het
Eno4	T	C	19: 58,960,247	F393S	possibly damaging	Het
Eral1	C	T	11: 78,078,357	D106N	probably benign	Het
Esp18	G	T	17: 39,408,179	R23M	probably benign	Het
Fam184b	C	T	5: 45,539,801	V674I	probably benign	Het
Fbxw13	A	C	9: 109,184,157	N154K	probably benign	Het
Gtpbp6	A	G	5: 110,107,125	V130A	probably damaging	Het
Hc	T	C	2: 35,013,038	D1067G	possibly damaging	Het
Ighg1	A	T	12: 113,330,506	S6T	unknown	Het
Ikzf3	C	T	11: 98,467,086	R475H	probably damaging	Het
Kcmf1	A	T	6: 72,842,930	L311*	probably null	Het
Kmt2d	C	A	15: 98,855,086	E184D	probably damaging	Het
Lrguk	A	T	6: 34,071,061	I314F	probably damaging	Het
Maml2	A	C	9: 13,706,467	S370R	probably damaging	Het
Mroh1	C	A	15: 76,432,347		probably benign	Het
Mx1	A	T	16: 97,454,147	Y235*	probably null	Het
Olfr1269	A	G	2: 90,118,669	*310Q	probably null	Het
Pamr1	T	G	2: 102,639,317	Y403D	probably damaging	Het
Panx2	A	G	15: 89,068,959	E551G	possibly damaging	Het
Patl2	A	G	2: 122,125,281	V258A	probably benign	Het
Ppm1m	A	G	9: 106,196,842	F255L	probably benign	Het
Prpf40a	G	T	2: 53,156,926	T266N	possibly damaging	Het
Psg18	T	A	7: 18,353,425	I103F	probably benign	Het
Rpl39-ps	A	G	15: 102,635,148		noncoding transcript	Het
Rps6kb1	A	T	11: 86,532,837	F106I	probably damaging	Het
Rsf1	CG	CGACGGCGGTG	7: 97,579,908		probably benign	Het
Sardh	G	T	2: 27,239,698	T245K	possibly damaging	Het
Shprh	T	G	10: 11,212,330	I1619S	possibly damaging	Het
Skint1	G	A	4: 112,025,532	V258I	probably benign	Het
Slc27a5	T	C	7: 12,994,942	D331G	probably benign	Het
Slc29a2	A	G	19: 5,029,275	I309V	probably benign	Het
Slc30a5	C	T	13: 100,821,172	V130I	possibly damaging	Het
Slc4a3	C	A	1: 75,552,656	A531D	probably damaging	Het
Slc6a16	C	T	7: 45,261,248	T399I	probably benign	Het
Slitrk6	T	A	14: 110,750,097	H726L	probably benign	Het
Snx2	A	G	18: 53,210,712	K309R	probably damaging	Het
Speer4f2	T	A	5: 17,373,219	C4S	possibly damaging	Het
Sulf1	T	C	1: 12,796,907	V105A	probably benign	Het
Tmem8b	G	A	4: 43,673,992	V208I	probably benign	Het
Vmn1r47	T	C	6: 90,022,213	L109P	probably damaging	Het
Vmn1r73	C	A	7: 11,756,449	Q65K	possibly damaging	Het
Vmn1r76	T	C	7: 11,930,684	Y166C	probably damaging	Het
Vmn2r2	T	C	3: 64,126,590	T504A	probably benign	Het
Wdr75	C	A	1: 45,812,164	A300E	probably benign	Het
Yars	A	G	4: 129,197,246	E149G	possibly damaging	Het
Zbtb18	T	C	1: 177,447,205	F35L	probably damaging	Het
Zfp366	A	G	13: 99,229,585	Y418C	probably damaging	Het

Other mutations in Atg14

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02088:Atg14	APN	14	47542859	missense	probably benign	0.00
IGL02513:Atg14	APN	14	47548994	missense	probably benign	0.03
IGL02513:Atg14	APN	14	47545624	splice site	probably benign
PIT4243001:Atg14	UTSW	14	47554574	missense	possibly damaging	0.77
R1463:Atg14	UTSW	14	47548994	missense	probably benign	0.03
R1479:Atg14	UTSW	14	47547239	critical splice donor site	probably null
R1499:Atg14	UTSW	14	47560645	missense	probably benign
R1781:Atg14	UTSW	14	47549150	critical splice acceptor site	probably null
R1974:Atg14	UTSW	14	47545841	missense	probably damaging	1.00
R2089:Atg14	UTSW	14	47542895	missense	probably damaging	1.00
R2091:Atg14	UTSW	14	47542895	missense	probably damaging	1.00
R2091:Atg14	UTSW	14	47542895	missense	probably damaging	1.00
R2113:Atg14	UTSW	14	47551324	missense	probably damaging	1.00
R4231:Atg14	UTSW	14	47551345	missense	probably benign	0.00
R4232:Atg14	UTSW	14	47551345	missense	probably benign	0.00
R4233:Atg14	UTSW	14	47551345	missense	probably benign	0.00
R4234:Atg14	UTSW	14	47551345	missense	probably benign	0.00
R4236:Atg14	UTSW	14	47551345	missense	probably benign	0.00
R4360:Atg14	UTSW	14	47568370	missense	probably benign	0.00
R4711:Atg14	UTSW	14	47545841	missense	probably damaging	1.00
R4883:Atg14	UTSW	14	47551314	missense	probably damaging	1.00
R5025:Atg14	UTSW	14	47545816	missense	probably damaging	1.00
R5235:Atg14	UTSW	14	47568199	missense	probably damaging	0.98
R5250:Atg14	UTSW	14	47568199	missense	probably damaging	0.98
R5297:Atg14	UTSW	14	47568199	missense	probably damaging	0.98
R5301:Atg14	UTSW	14	47568199	missense	probably damaging	0.98
R5338:Atg14	UTSW	14	47568199	missense	probably damaging	0.98
R5475:Atg14	UTSW	14	47568336	missense	possibly damaging	0.83
R5799:Atg14	UTSW	14	47547295	missense	possibly damaging	0.63
R6489:Atg14	UTSW	14	47549023	missense	probably damaging	0.97
R7589:Atg14	UTSW	14	47543090	missense	probably benign	0.00
R7908:Atg14	UTSW	14	47568593	unclassified	probably benign
R9478:Atg14	UTSW	14	47545681	missense	probably damaging	1.00
R9643:Atg14	UTSW	14	47551323	missense	probably damaging	0.99
Z1088:Atg14	UTSW	14	47568292	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GCTCTAGGATGTGTGACCTTC -3'
(R):5'- TAATGGGACCAGTGTAGGGC -3'

Sequencing Primer
(F):5'- ATGTGTGACCTTCGAAGCC -3'
(R):5'- ACCAGTGTAGGGCGACTG -3'

Posted On

2016-09-06