Incidental Mutation 'R6064:Bach1'
ID483988
Institutional Source Beutler Lab
Gene Symbol Bach1
Ensembl Gene ENSMUSG00000025612
Gene NameBTB and CNC homology 1, basic leucine zipper transcription factor 1
Synonyms
MMRRC Submission 044228-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6064 (G1)
Quality Score198.009
Status Not validated
Chromosome16
Chromosomal Location87698945-87733346 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 87729864 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 738 (D738G)
Ref Sequence ENSEMBL: ENSMUSP00000026703 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026703]
PDB Structure
Structure of mouse Bach1 BTB domain [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000026703
AA Change: D738G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000026703
Gene: ENSMUSG00000025612
AA Change: D738G

DomainStartEndE-ValueType
BTB 34 130 1.23e-24 SMART
Blast:BTB 153 235 2e-29 BLAST
low complexity region 378 390 N/A INTRINSIC
low complexity region 504 517 N/A INTRINSIC
BRLZ 556 622 1.2e-12 SMART
low complexity region 699 717 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151046
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 93.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transcription factor that belongs to the cap'n'collar type of basic region leucine zipper factor family (CNC-bZip). The encoded protein contains broad complex, tramtrack, bric-a-brac/poxvirus and zinc finger (BTB/POZ) domains, which is atypical of CNC-bZip family members. These BTB/POZ domains facilitate protein-protein interactions and formation of homo- and/or hetero-oligomers. When this encoded protein forms a heterodimer with MafK, it functions as a repressor of Maf recognition element (MARE) and transcription is repressed. Multiple alternatively spliced transcript variants have been identified for this gene. [provided by RefSeq, May 2009]
PHENOTYPE: Homozygous null mice are healthy and fertile with no gross abnormalities but express elevated levels of HMOX1. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgra3 C T 5: 49,960,325 D1294N probably damaging Het
Atf1 A G 15: 100,252,148 T92A probably benign Het
Catsper3 T C 13: 55,806,252 F278L probably damaging Het
Chsy3 GT G 18: 59,176,166 probably null Het
Cmya5 T A 13: 93,089,649 N2977I probably damaging Het
Cnbd1 T A 4: 18,895,084 E219D probably benign Het
Dst A G 1: 34,194,051 D3556G probably damaging Het
Duox1 A G 2: 122,320,762 E306G probably benign Het
Fstl5 T A 3: 76,322,298 F135L probably benign Het
Fyb A C 15: 6,638,868 K514T probably damaging Het
Gsap T A 5: 21,229,225 C280S possibly damaging Het
Lrig1 T C 6: 94,626,447 E240G probably damaging Het
Macc1 A T 12: 119,445,665 H56L probably benign Het
Mroh2a GCCC GC 1: 88,232,257 probably null Het
Muc6 T C 7: 141,648,374 R696G probably damaging Het
Nup210 T C 6: 91,055,291 I32V probably benign Het
Olfr1155 A G 2: 87,943,484 M48T probably benign Het
Olfr183 T G 16: 58,999,823 I46S probably damaging Het
Olfr668 C T 7: 104,925,392 R124H probably benign Het
Ovch2 T C 7: 107,796,572 T80A probably damaging Het
Rad51ap2 T A 12: 11,457,417 Y447N possibly damaging Het
Rb1cc1 A G 1: 6,249,734 T1126A probably benign Het
Scgb1b10 T C 7: 32,101,202 L72S probably damaging Het
Slc25a33 A G 4: 149,752,464 V141A probably benign Het
Tbx21 T C 11: 97,114,911 Y76C probably damaging Het
Tmem235 T C 11: 117,862,938 V107A possibly damaging Het
Vnn1 G T 10: 23,894,909 A12S probably benign Het
Zfp606 T G 7: 12,481,033 W63G possibly damaging Het
Zfp788 T A 7: 41,648,454 F119L probably benign Het
Other mutations in Bach1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01553:Bach1 APN 16 87722505 missense probably damaging 1.00
R0626:Bach1 UTSW 16 87729471 missense possibly damaging 0.94
R0701:Bach1 UTSW 16 87719989 missense probably damaging 0.99
R1070:Bach1 UTSW 16 87720121 missense probably benign 0.02
R1160:Bach1 UTSW 16 87715434 missense probably benign 0.34
R2066:Bach1 UTSW 16 87729625 missense probably damaging 0.99
R2235:Bach1 UTSW 16 87720113 missense probably damaging 1.00
R4716:Bach1 UTSW 16 87715379 start gained probably benign
R4801:Bach1 UTSW 16 87722452 missense probably damaging 0.99
R4802:Bach1 UTSW 16 87722452 missense probably damaging 0.99
R4989:Bach1 UTSW 16 87719000 missense possibly damaging 0.94
R5016:Bach1 UTSW 16 87719318 missense possibly damaging 0.88
R5527:Bach1 UTSW 16 87719545 missense probably benign 0.01
R5657:Bach1 UTSW 16 87719285 missense probably benign 0.00
R6384:Bach1 UTSW 16 87719857 nonsense probably null
R7009:Bach1 UTSW 16 87719291 missense probably benign 0.10
R7027:Bach1 UTSW 16 87719291 missense probably benign 0.10
R7028:Bach1 UTSW 16 87719291 missense probably benign 0.10
R7029:Bach1 UTSW 16 87719291 missense probably benign 0.10
R7030:Bach1 UTSW 16 87719291 missense probably benign 0.10
R7095:Bach1 UTSW 16 87719291 missense probably benign 0.10
R7096:Bach1 UTSW 16 87719291 missense probably benign 0.10
R7192:Bach1 UTSW 16 87729663 missense possibly damaging 0.71
R7385:Bach1 UTSW 16 87729497 missense probably damaging 0.99
R7571:Bach1 UTSW 16 87719291 missense probably benign 0.10
R7572:Bach1 UTSW 16 87719291 missense probably benign 0.10
R7623:Bach1 UTSW 16 87719291 missense probably benign 0.10
R7632:Bach1 UTSW 16 87720143 missense probably benign 0.00
R7714:Bach1 UTSW 16 87718848 nonsense probably null
R7715:Bach1 UTSW 16 87719971 missense possibly damaging 0.82
R7746:Bach1 UTSW 16 87729633 missense probably benign 0.00
R7896:Bach1 UTSW 16 87719005 missense possibly damaging 0.63
R8129:Bach1 UTSW 16 87722426 missense possibly damaging 0.51
R8169:Bach1 UTSW 16 87722502 missense possibly damaging 0.93
R8296:Bach1 UTSW 16 87729579 missense probably damaging 1.00
R8300:Bach1 UTSW 16 87719108 missense probably benign
R8388:Bach1 UTSW 16 87719291 missense probably benign 0.10
R8389:Bach1 UTSW 16 87719291 missense probably benign 0.10
R8391:Bach1 UTSW 16 87719291 missense probably benign 0.10
Predicted Primers PCR Primer
(F):5'- GACGGCGAGCTTGCTTTTAC -3'
(R):5'- CATCCAATTTCCCATCATTCAAGAG -3'

Sequencing Primer
(F):5'- CAGTGTGTCTGACGTGCCTC -3'
(R):5'- GAACATCTCCTATGAAAACCAAGGAG -3'
Posted On2017-07-14