Incidental Mutation 'R8869:Wdr70'
ID676156
Institutional Source Beutler Lab
Gene Symbol Wdr70
Ensembl Gene ENSMUSG00000039828
Gene NameWD repeat domain 70
Synonyms4833422F06Rik
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.966) question?
Stock #R8869 (G1)
Quality Score225.009
Status Not validated
Chromosome15
Chromosomal Location7873055-8099209 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 8093726 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 42 (M42K)
Ref Sequence ENSEMBL: ENSMUSP00000037340 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045766] [ENSMUST00000227371]
Predicted Effect probably benign
Transcript: ENSMUST00000045766
AA Change: M42K

PolyPhen 2 Score 0.024 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000037340
Gene: ENSMUSG00000039828
AA Change: M42K

DomainStartEndE-ValueType
coiled coil region 51 81 N/A INTRINSIC
low complexity region 137 167 N/A INTRINSIC
WD40 174 213 1.61e-3 SMART
WD40 220 260 3.2e0 SMART
WD40 272 315 1.03e0 SMART
WD40 324 363 1.7e-2 SMART
WD40 367 409 1.38e-2 SMART
Blast:WD40 413 460 5e-16 BLAST
WD40 463 502 3.44e0 SMART
low complexity region 570 586 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000227371
AA Change: M42K

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1300017J02Rik T C 9: 103,272,632 Y242C probably damaging Het
4833427G06Rik T A 9: 51,081,532 probably null Het
4932438A13Rik T A 3: 36,958,858 C1895S probably damaging Het
Acsl5 G A 19: 55,278,091 R114Q possibly damaging Het
Atp1a4 C T 1: 172,227,123 V980I probably benign Het
Brd1 A T 15: 88,730,526 D55E probably benign Het
Cachd1 A G 4: 100,952,083 D255G probably benign Het
Ces2f C A 8: 104,950,072 P133T probably damaging Het
Clock GGCTGCTGCTGCTGCTGCTGCTGCTG GGCTGCTGCTGCTGCTGCTGCTG 5: 76,227,042 probably benign Het
Cyp4f37 A T 17: 32,625,122 I67F probably benign Het
Dbf4 T C 5: 8,398,656 I84V Het
Dcc T C 18: 71,378,684 T887A probably benign Het
Dhdh G T 7: 45,488,112 N50K probably benign Het
Dnah7c A T 1: 46,632,344 E1631V probably damaging Het
Dusp23 A G 1: 172,632,726 C53R possibly damaging Het
Efcab6 G A 15: 84,044,231 S54L probably damaging Het
Fcamr T C 1: 130,811,598 F212L probably damaging Het
Gfap G C 11: 102,896,984 A45G probably benign Het
Gm6614 A G 6: 141,982,084 V548A probably damaging Het
Gm8251 A T 1: 44,058,265 D1224E possibly damaging Het
Grm8 C T 6: 27,363,753 V588M probably benign Het
H1foo A G 6: 115,949,950 T263A probably benign Het
Malrd1 T A 2: 15,565,557 probably null Het
Mxi1 G A 19: 53,371,695 G283S probably damaging Het
Myh15 T C 16: 49,177,003 V1728A probably benign Het
Nxph2 T A 2: 23,400,059 V141D probably damaging Het
Olfr1128 A T 2: 87,545,409 M45K probably damaging Het
Olfr1163 T A 2: 88,071,409 probably null Het
Olfr1310 A T 2: 112,008,251 S312T possibly damaging Het
Olfr1395 A T 11: 49,148,656 Y133F probably damaging Het
Olfr1480 A T 19: 13,530,528 N329I probably damaging Het
Olfr193 A G 16: 59,109,758 V284A Het
Olfr250 A G 9: 38,367,846 N90S possibly damaging Het
Olfr323 T C 11: 58,625,168 E106G unknown Het
Otof T A 5: 30,420,981 I108F probably benign Het
Pcdha4 A T 18: 36,952,958 R65* probably null Het
Pde11a T C 2: 76,211,090 H412R probably benign Het
Peli3 C T 19: 4,932,513 G375S probably damaging Het
Ppp6r3 A G 19: 3,511,927 probably null Het
Prcp T C 7: 92,910,310 V194A possibly damaging Het
Prkce T C 17: 86,168,942 probably null Het
Prss23 A T 7: 89,510,679 S61T probably benign Het
Ptprq C T 10: 107,699,608 R432H probably damaging Het
Rnase2a T A 14: 51,255,644 N88I possibly damaging Het
Rspry1 G T 8: 94,633,152 L230F probably damaging Het
Smpd2 A G 10: 41,489,305 L65P probably benign Het
Sorl1 A G 9: 42,022,426 Y1083H probably benign Het
Tjp1 A G 7: 65,336,638 S241P probably damaging Het
Tmed6 A C 8: 107,065,532 L27R probably damaging Het
Tmem52 G A 4: 155,469,331 C32Y probably damaging Het
Tmprss15 C A 16: 78,953,946 G1022* probably null Het
Ttn T C 2: 76,900,001 S5085G unknown Het
Vmn2r37 C T 7: 9,206,855 V553M possibly damaging Het
Wdr66 A T 5: 123,322,442 M1156L possibly damaging Het
Zfp735 T A 11: 73,711,684 C485S possibly damaging Het
Other mutations in Wdr70
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00777:Wdr70 APN 15 8019607 missense probably benign 0.07
IGL01121:Wdr70 APN 15 7873174 missense possibly damaging 0.53
IGL01508:Wdr70 APN 15 8079263 missense probably benign 0.33
IGL01801:Wdr70 APN 15 7887324 splice site probably null
IGL01815:Wdr70 APN 15 7887324 splice site probably null
IGL01929:Wdr70 APN 15 7920634 splice site probably null
IGL02150:Wdr70 APN 15 8082546 missense possibly damaging 0.72
IGL02245:Wdr70 APN 15 8046482 missense possibly damaging 0.86
IGL02541:Wdr70 APN 15 7884302 nonsense probably null
IGL02800:Wdr70 APN 15 8082496 missense probably benign 0.25
IGL02829:Wdr70 APN 15 7976982 missense possibly damaging 0.92
IGL02831:Wdr70 APN 15 7884306 missense possibly damaging 0.86
IGL03169:Wdr70 APN 15 7884340 missense possibly damaging 0.73
IGL03405:Wdr70 APN 15 8035871 missense possibly damaging 0.73
R0106:Wdr70 UTSW 15 8019587 critical splice donor site probably null
R0106:Wdr70 UTSW 15 8019587 critical splice donor site probably null
R0462:Wdr70 UTSW 15 8079161 missense probably benign 0.00
R0539:Wdr70 UTSW 15 7885637 missense possibly damaging 0.96
R1398:Wdr70 UTSW 15 8035844 missense probably benign 0.01
R1812:Wdr70 UTSW 15 8079179 missense probably benign 0.00
R1863:Wdr70 UTSW 15 7920573 missense probably benign 0.25
R1913:Wdr70 UTSW 15 7884410 missense possibly damaging 0.72
R2425:Wdr70 UTSW 15 7887359 nonsense probably null
R4013:Wdr70 UTSW 15 8079214 nonsense probably null
R4015:Wdr70 UTSW 15 8079214 nonsense probably null
R4017:Wdr70 UTSW 15 8079214 nonsense probably null
R4111:Wdr70 UTSW 15 7976991 missense probably benign 0.32
R5241:Wdr70 UTSW 15 8079216 missense probably benign
R5277:Wdr70 UTSW 15 7976984 nonsense probably null
R5306:Wdr70 UTSW 15 7924273 missense probably benign 0.04
R5426:Wdr70 UTSW 15 7922105 missense possibly damaging 0.59
R5586:Wdr70 UTSW 15 7884288 missense possibly damaging 0.86
R6010:Wdr70 UTSW 15 7887419 splice site probably null
R6035:Wdr70 UTSW 15 7887349 missense possibly damaging 0.86
R6035:Wdr70 UTSW 15 7887349 missense possibly damaging 0.86
R6109:Wdr70 UTSW 15 8079154 splice site probably null
R6139:Wdr70 UTSW 15 8079251 missense probably benign 0.04
R6400:Wdr70 UTSW 15 8042841 missense probably benign 0.32
R6456:Wdr70 UTSW 15 7885637 missense possibly damaging 0.96
R6518:Wdr70 UTSW 15 8079337 missense unknown
R7036:Wdr70 UTSW 15 7884374 missense possibly damaging 0.85
R7056:Wdr70 UTSW 15 7884396 missense possibly damaging 0.53
R7341:Wdr70 UTSW 15 7924244 missense possibly damaging 0.71
R7484:Wdr70 UTSW 15 7922081 missense probably benign 0.23
R7572:Wdr70 UTSW 15 8035846 missense possibly damaging 0.85
R7652:Wdr70 UTSW 15 8079216 missense probably benign
R7886:Wdr70 UTSW 15 8079249 missense probably benign 0.02
R8103:Wdr70 UTSW 15 7977131 missense possibly damaging 0.70
R8214:Wdr70 UTSW 15 7887370 missense probably benign 0.03
R8252:Wdr70 UTSW 15 8042856 splice site probably benign
Predicted Primers PCR Primer
(F):5'- GGAACCAGAAATTACAATTCTCTCAGC -3'
(R):5'- ACTTCTGGTCCAAGCATTGTAG -3'

Sequencing Primer
(F):5'- TCAGCAATTCTGATTTAAATGGGAG -3'
(R):5'- CTGGTCCAAGCATTGTAGGTAATAG -3'
Posted On2021-07-15