Mutagenetix > Incidental Mutation

Incidental Mutation 'R6139:Gsap'

488479

Institutional Source

Beutler Lab

Gene Symbol

Gsap

Ensembl Gene

ENSMUSG00000039934

Gene Name

gamma-secretase activating protein

Synonyms

A530088I07Rik, Pion

MMRRC Submission

044286-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.114) question?

Stock #

R6139 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

21186255-21315132 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 21281540 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Aspartic acid at position 649 (V649D)

Ref Sequence

ENSEMBL: ENSMUSP00000142986 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000036031] [ENSMUST00000195969] [ENSMUST00000198014] [ENSMUST00000198937]

AlphaFold

Q3TCV3

Predicted Effect

probably damaging
Transcript: ENSMUST00000036031
AA Change: V680D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000043679
Gene: ENSMUSG00000039934
AA Change: V680D

Domain	Start	End	E-Value	Type
low complexity region	386	398	N/A	INTRINSIC
Pfam:GSAP-16	646	753	6.8e-43	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000195969

Predicted Effect

probably benign
Transcript: ENSMUST00000198014

Predicted Effect

probably damaging
Transcript: ENSMUST00000198937
AA Change: V649D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000142986
Gene: ENSMUSG00000039934
AA Change: V649D

Domain	Start	End	E-Value	Type
low complexity region	355	367	N/A	INTRINSIC
Pfam:GSAP-16	608	722	1.6e-42	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000199242

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.4%
20x: 95.7%

Validation Efficiency

100% (50/50)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Accumulation of neurotoxic amyloid-beta is a major hallmark of Alzheimer disease (AD; MIM 104300). Formation of amyloid-beta is catalyzed by gamma-secretase (see PSEN1; MIM 104311), a protease with numerous substrates. PION, or GSAP, selectively increases amyloid-beta production through a mechanism involving its interaction with both gamma-secretase and its substrate, the amyloid-beta precursor protein (APP; MIM 104760) C-terminal fragment (APP-CTF) (He et al., 2010 [PubMed 20811458]).[supplied by OMIM, Nov 2010]

Allele List at MGI

Other mutations in this stock

Total: 50 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
6030468B19Rik	A	G	11: 117,806,324	T250A	probably damaging	Het
Acacb	T	C	5: 114,212,652	I1074T	probably damaging	Het
Acsl6	C	A	11: 54,340,542	P462T	probably damaging	Het
Aebp1	A	G	11: 5,871,842	D747G	probably damaging	Het
Antxr2	A	C	5: 97,977,706		probably null	Het
Arhgap35	T	C	7: 16,563,467	T558A	possibly damaging	Het
Asap1	T	A	15: 64,166,539	I223F	possibly damaging	Het
C2cd5	A	C	6: 143,035,058	D669E	probably damaging	Het
Casz1	C	T	4: 148,951,697	T1472M	probably damaging	Het
Catsper4	A	G	4: 134,217,866	L154P	probably damaging	Het
Cep350	T	C	1: 155,953,279	E293G	probably benign	Het
Cma1	T	A	14: 55,942,700		probably null	Het
Ddx42	C	T	11: 106,240,017	A439V	probably damaging	Het
Disp2	T	A	2: 118,790,662	L625Q	probably damaging	Het
Dnah1	T	C	14: 31,286,027	D2141G	probably benign	Het
Dsp	T	C	13: 38,192,406	I1389T	probably damaging	Het
Fam81a	A	T	9: 70,102,818		probably null	Het
Fsip2	A	G	2: 82,991,044	D5707G	possibly damaging	Het
Gcnt4	G	A	13: 96,946,852	V219I	probably benign	Het
Gk2	A	G	5: 97,456,280	V233A	probably benign	Het
Grm1	T	C	10: 10,746,331		probably benign	Het
Kif1b	G	A	4: 149,237,532	H977Y	possibly damaging	Het
Ktn1	T	A	14: 47,726,215		probably null	Het
Lgals12	T	A	19: 7,604,377	T29S	probably benign	Het
Me3	G	T	7: 89,632,900		probably benign	Het
Mgst3	T	G	1: 167,378,305	K35T	possibly damaging	Het
Mtmr9	T	C	14: 63,529,778	R354G	probably benign	Het
Myh11	T	C	16: 14,215,874	E1059G	probably damaging	Het
Nr4a2	T	A	2: 57,108,689	H408L	probably damaging	Het
Olfr689	A	T	7: 105,314,246	T81S	probably damaging	Het
Olfr993	A	T	2: 85,414,346	F178I	probably damaging	Het
Pds5b	T	A	5: 150,800,777	L1275Q	possibly damaging	Het
Pfkfb4	A	G	9: 109,027,757	Y412C	probably damaging	Het
Pop1	T	A	15: 34,529,058	C745S	probably benign	Het
Ptpn14	T	G	1: 189,851,165	S736R	probably benign	Het
Rdh9	A	T	10: 127,776,737	T85S	possibly damaging	Het
Rnf223	T	C	4: 156,132,803	C212R	probably damaging	Het
Rnf39	A	G	17: 36,943,338	E84G	probably damaging	Het
Sfmbt1	T	A	14: 30,811,418	V584D	probably damaging	Het
Slc12a5	T	A	2: 164,992,311	S728T	probably damaging	Het
Slc16a12	T	A	19: 34,670,895		probably null	Het
Snupn	C	A	9: 56,982,824	Q310K	possibly damaging	Het
St7	T	C	6: 17,694,354	L48P	probably damaging	Het
Thsd7a	T	C	6: 12,379,573	N951D	possibly damaging	Het
Ttn	G	A	2: 76,852,069	R959*	probably null	Het
Ugt2b36	A	T	5: 87,092,171	D118E	probably benign	Het
Vmn2r7	G	A	3: 64,715,918	T327I	probably damaging	Het
Wdr70	T	C	15: 8,079,251	D137G	probably benign	Het
Wrn	A	T	8: 33,353,332	M14K	probably damaging	Het
Xpot	T	A	10: 121,611,708	E283V	probably benign	Het

Other mutations in Gsap

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00788:Gsap	APN	5	21221305	splice site	probably benign
IGL00788:Gsap	APN	5	21254024	missense	probably damaging	0.96
IGL01344:Gsap	APN	5	21242883	critical splice donor site	probably null
IGL01347:Gsap	APN	5	21226320	missense	probably benign	0.08
IGL01618:Gsap	APN	5	21226248	missense	probably damaging	1.00
IGL01730:Gsap	APN	5	21290154	unclassified	probably benign
IGL02061:Gsap	APN	5	21281611	splice site	probably benign
IGL02161:Gsap	APN	5	21253379	missense	probably damaging	1.00
IGL02259:Gsap	APN	5	21186400	missense	probably benign	0.01
IGL02635:Gsap	APN	5	21289816	missense	probably damaging	1.00
IGL02684:Gsap	APN	5	21242803	critical splice acceptor site	probably null
IGL02822:Gsap	APN	5	21217444	missense	probably damaging	1.00
IGL03231:Gsap	APN	5	21229166	missense	probably damaging	0.99
PIT4305001:Gsap	UTSW	5	21186409	missense	probably damaging	0.98
R0012:Gsap	UTSW	5	21226229	splice site	probably benign
R0012:Gsap	UTSW	5	21226229	splice site	probably benign
R0019:Gsap	UTSW	5	21270622	splice site	probably benign
R0019:Gsap	UTSW	5	21270622	splice site	probably benign
R0045:Gsap	UTSW	5	21226832	missense	possibly damaging	0.77
R0054:Gsap	UTSW	5	21250935	splice site	probably benign
R0054:Gsap	UTSW	5	21250935	splice site	probably benign
R0409:Gsap	UTSW	5	21222445	splice site	probably benign
R0507:Gsap	UTSW	5	21269963	missense	possibly damaging	0.75
R0624:Gsap	UTSW	5	21253951	splice site	probably null
R1037:Gsap	UTSW	5	21251165	splice site	probably benign
R1076:Gsap	UTSW	5	21287694	missense	possibly damaging	0.75
R1459:Gsap	UTSW	5	21207238	splice site	probably benign
R1757:Gsap	UTSW	5	21281037	missense	probably damaging	0.98
R1852:Gsap	UTSW	5	21290545	splice site	probably null
R2034:Gsap	UTSW	5	21270595	missense	probably damaging	1.00
R2069:Gsap	UTSW	5	21226839	splice site	probably benign
R2125:Gsap	UTSW	5	21242813	missense	probably damaging	1.00
R2172:Gsap	UTSW	5	21222440	critical splice donor site	probably null
R2310:Gsap	UTSW	5	21196090	nonsense	probably null
R2337:Gsap	UTSW	5	21288630	missense	probably damaging	1.00
R3442:Gsap	UTSW	5	21278127	missense	probably damaging	1.00
R4229:Gsap	UTSW	5	21246977	missense	probably benign	0.00
R4271:Gsap	UTSW	5	21226350	critical splice donor site	probably null
R4551:Gsap	UTSW	5	21290571	missense	probably damaging	1.00
R4553:Gsap	UTSW	5	21290571	missense	probably damaging	1.00
R4649:Gsap	UTSW	5	21226311	missense	probably damaging	1.00
R4687:Gsap	UTSW	5	21246971	utr 3 prime	probably benign
R4799:Gsap	UTSW	5	21250943	missense	probably benign	0.05
R4857:Gsap	UTSW	5	21287799	splice site	probably null
R4973:Gsap	UTSW	5	21254039	missense	probably benign	0.04
R5015:Gsap	UTSW	5	21222408	missense	probably damaging	1.00
R5031:Gsap	UTSW	5	21242826	missense	possibly damaging	0.57
R5120:Gsap	UTSW	5	21269936	missense	probably damaging	0.96
R5451:Gsap	UTSW	5	21217447	missense	probably damaging	1.00
R5469:Gsap	UTSW	5	21290544	missense	possibly damaging	0.92
R5519:Gsap	UTSW	5	21289859	missense	probably damaging	1.00
R5588:Gsap	UTSW	5	21251149	missense	probably damaging	1.00
R5650:Gsap	UTSW	5	21251053	missense	probably damaging	0.99
R6064:Gsap	UTSW	5	21229225	missense	possibly damaging	0.56
R6148:Gsap	UTSW	5	21226325	missense	probably damaging	1.00
R6148:Gsap	UTSW	5	21270577	missense	probably benign	0.39
R6226:Gsap	UTSW	5	21217431	missense	probably damaging	1.00
R6859:Gsap	UTSW	5	21281018	missense	probably damaging	0.99
R6977:Gsap	UTSW	5	21271221	missense	probably damaging	1.00
R6995:Gsap	UTSW	5	21271237	missense	possibly damaging	0.58
R7013:Gsap	UTSW	5	21278110	missense	probably benign	0.39
R7159:Gsap	UTSW	5	21270620	splice site	probably null
R7181:Gsap	UTSW	5	21253429	missense	probably damaging	1.00
R7234:Gsap	UTSW	5	21186435	missense	probably benign
R7332:Gsap	UTSW	5	21290121	missense	probably benign	0.00
R7381:Gsap	UTSW	5	21226787	missense	probably damaging	0.96
R8047:Gsap	UTSW	5	21257868	critical splice acceptor site	probably null
R8062:Gsap	UTSW	5	21194463	missense	probably damaging	1.00
R8126:Gsap	UTSW	5	21270012	missense	probably benign	0.04
R8219:Gsap	UTSW	5	21251115	missense	probably benign	0.00
R8355:Gsap	UTSW	5	21251019	nonsense	probably null
R8472:Gsap	UTSW	5	21222434	nonsense	probably null
R8715:Gsap	UTSW	5	21226247	missense	possibly damaging	0.84
R8745:Gsap	UTSW	5	21269951	missense	probably benign	0.05
R8798:Gsap	UTSW	5	21271250	critical splice donor site	probably null
R9080:Gsap	UTSW	5	21194412	missense	possibly damaging	0.52
R9120:Gsap	UTSW	5	21253436	missense	probably damaging	1.00
R9178:Gsap	UTSW	5	21217473	missense	probably damaging	0.98
R9209:Gsap	UTSW	5	21228066	missense	probably benign	0.10
R9404:Gsap	UTSW	5	21269921	missense	probably damaging	1.00
Z1177:Gsap	UTSW	5	21251032	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- GCCCACTATTTCCAAGGACAG -3'
(R):5'- TAGTGGCCAACCTCAAGACC -3'

Sequencing Primer
(F):5'- AGACTACTGAGTATGGTGTGAGATTC -3'
(R):5'- AGACCAACCCGCTGCTG -3'

Posted On

2017-10-10