Incidental Mutation 'R5868:Npr1'
ID490491
Institutional Source Beutler Lab
Gene Symbol Npr1
Ensembl Gene ENSMUSG00000027931
Gene Namenatriuretic peptide receptor 1
SynonymsNPRA, guanylyl cyclase-A, GC-A, NPR-A
MMRRC Submission 044076-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.141) question?
Stock #R5868 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location90450591-90465866 bp(-) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) A to G at 90459493 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000029540 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029540]
Predicted Effect probably benign
Transcript: ENSMUST00000029540
SMART Domains Protein: ENSMUSP00000029540
Gene: ENSMUSG00000027931

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Pfam:ANF_receptor 50 410 4.7e-54 PFAM
low complexity region 468 488 N/A INTRINSIC
Pfam:Pkinase_Tyr 538 797 1.2e-39 PFAM
Pfam:Pkinase 543 796 8.7e-31 PFAM
CYCc 836 1030 5.04e-112 SMART
Predicted Effect unknown
Transcript: ENSMUST00000124760
AA Change: V48A
SMART Domains Protein: ENSMUSP00000118023
Gene: ENSMUSG00000027931
AA Change: V48A

DomainStartEndE-ValueType
PDB:3A3K|B 2 20 1e-8 PDB
transmembrane domain 25 47 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134250
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142243
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146991
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.2%
  • 20x: 90.8%
Validation Efficiency 95% (58/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Guanylyl cyclases, catalyzing the production of cGMP from GTP, are classified as soluble and membrane forms (Garbers and Lowe, 1994 [PubMed 7982997]). The membrane guanylyl cyclases, often termed guanylyl cyclases A through F, form a family of cell-surface receptors with a similar topographic structure: an extracellular ligand-binding domain, a single membrane-spanning domain, and an intracellular region that contains a protein kinase-like domain and a cyclase catalytic domain. GC-A and GC-B function as receptors for natriuretic peptides; they are also referred to as atrial natriuretic peptide receptor A (NPR1) and type B (NPR2; MIM 108961). Also see NPR3 (MIM 108962), which encodes a protein with only the ligand-binding transmembrane and 37-amino acid cytoplasmic domains. NPR1 is a membrane-bound guanylate cyclase that serves as the receptor for both atrial and brain natriuretic peptides (ANP (MIM 108780) and BNP (MIM 600295), respectively).[supplied by OMIM, May 2009]
PHENOTYPE: Homozygous inactivation of this gene can lead to hypertension, cardiac hypertrophy, lethal vascular events, congestive heart failure in response to volume overload, reduced serum testosterone levels, altered steroidogenesis, and reduced myocardial PMN infiltration and infarct size after I/R injury. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810408A11Rik C A 11: 69,897,575 K394N possibly damaging Het
4930451G09Rik T C 16: 4,974,068 noncoding transcript Het
Adamts18 T A 8: 113,777,748 Q80L possibly damaging Het
Apbb2 T A 5: 66,452,096 K69N probably damaging Het
Ascc3 C T 10: 50,842,183 R1991* probably null Het
BC035947 T A 1: 78,498,323 N524I probably damaging Het
Bpifa1 A G 2: 154,143,876 N37S unknown Het
Crnkl1 A T 2: 145,918,553 D648E probably benign Het
Cul5 C A 9: 53,658,673 G86V probably benign Het
Cyfip1 A C 7: 55,926,313 D1077A probably damaging Het
Dennd4a T C 9: 64,896,729 S1117P probably benign Het
Elmo2 A T 2: 165,294,272 M618K possibly damaging Het
Fam205c A T 4: 42,871,711 D221E probably damaging Het
Fggy A G 4: 95,696,988 T35A probably damaging Het
Gad2 G A 2: 22,685,067 probably null Het
Gtf3c2 A C 5: 31,168,081 F455V possibly damaging Het
Hacl1 C A 14: 31,619,916 A311S probably damaging Het
Hist4h4 C T 6: 136,804,294 G29D probably damaging Het
Kat6b G A 14: 21,634,479 D611N probably damaging Het
Kifap3 T C 1: 163,865,472 I611T probably damaging Het
Lrba A G 3: 86,319,604 Y683C probably damaging Het
Maats1 T A 16: 38,332,242 D202V probably damaging Het
Mfsd14a T C 3: 116,633,750 N413S probably benign Het
Mtmr11 T A 3: 96,171,202 D691E possibly damaging Het
Mzf1 A T 7: 13,053,189 F64I probably benign Het
Neu2 G T 1: 87,596,756 Q154H probably damaging Het
Nid1 T C 13: 13,489,157 probably null Het
Nod1 C A 6: 54,939,327 K128N probably damaging Het
Noxred1 T A 12: 87,224,202 Q215L possibly damaging Het
Npat A G 9: 53,570,124 E1044G probably damaging Het
Pdcd6 T C 13: 74,304,014 D169G probably damaging Het
Pld3 G T 7: 27,537,668 T262N probably benign Het
Plxna1 T C 6: 89,322,722 probably benign Het
Prh1 A G 6: 132,572,211 Q227R unknown Het
Prtg C A 9: 72,809,717 Y113* probably null Het
Rbm27 T A 18: 42,300,385 V242E possibly damaging Het
Ripor1 T C 8: 105,616,004 L198P probably damaging Het
Rnpc3 T C 3: 113,616,711 probably null Het
Serpinf2 T C 11: 75,433,239 T321A probably benign Het
Sh3gl1 T C 17: 56,019,119 D129G probably damaging Het
Slc12a2 C A 18: 57,943,996 P1189Q probably damaging Het
Slc16a9 T C 10: 70,282,490 M213T probably benign Het
Svil G A 18: 5,056,854 probably null Het
Synpo A G 18: 60,604,046 L37P probably damaging Het
Tmprss9 A G 10: 80,882,746 H87R probably benign Het
Tmtc1 A T 6: 148,237,855 L885Q probably damaging Het
Ttc41 T C 10: 86,750,264 S811P possibly damaging Het
Vmn2r23 T C 6: 123,712,942 V259A probably benign Het
Wwox T A 8: 114,679,846 H192Q probably benign Het
Other mutations in Npr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01077:Npr1 APN 3 90458362 missense probably damaging 1.00
IGL01432:Npr1 APN 3 90463236 missense possibly damaging 0.85
IGL02106:Npr1 APN 3 90464858 missense probably benign 0.12
IGL03310:Npr1 APN 3 90455991 missense probably benign 0.30
PIT4581001:Npr1 UTSW 3 90462257 missense probably damaging 1.00
R0010:Npr1 UTSW 3 90454832 missense probably damaging 1.00
R0137:Npr1 UTSW 3 90455937 missense probably damaging 1.00
R0384:Npr1 UTSW 3 90465167 missense probably damaging 0.98
R0656:Npr1 UTSW 3 90461369 missense probably benign
R0941:Npr1 UTSW 3 90461409 missense probably benign
R0961:Npr1 UTSW 3 90458721 missense possibly damaging 0.91
R1172:Npr1 UTSW 3 90461382 missense probably benign 0.01
R1747:Npr1 UTSW 3 90458669 missense possibly damaging 0.88
R1763:Npr1 UTSW 3 90459337 missense probably damaging 0.98
R1900:Npr1 UTSW 3 90462188 missense probably damaging 0.98
R3807:Npr1 UTSW 3 90458726 missense probably damaging 0.98
R4017:Npr1 UTSW 3 90456232 missense probably damaging 1.00
R4437:Npr1 UTSW 3 90456286 missense probably damaging 1.00
R4900:Npr1 UTSW 3 90455965 missense possibly damaging 0.77
R5265:Npr1 UTSW 3 90457002 missense probably benign 0.29
R5343:Npr1 UTSW 3 90458208 missense possibly damaging 0.94
R5590:Npr1 UTSW 3 90454842 missense probably damaging 0.99
R6782:Npr1 UTSW 3 90456253 missense probably benign 0.18
R6828:Npr1 UTSW 3 90464813 missense probably benign
R6903:Npr1 UTSW 3 90455145 missense possibly damaging 0.67
R7592:Npr1 UTSW 3 90465016 missense possibly damaging 0.52
R7841:Npr1 UTSW 3 90454868 missense probably damaging 1.00
R8202:Npr1 UTSW 3 90461424 missense probably benign
R8671:Npr1 UTSW 3 90456157 unclassified probably benign
R8683:Npr1 UTSW 3 90455190 missense probably benign 0.38
R8819:Npr1 UTSW 3 90464894 missense probably damaging 0.96
R8820:Npr1 UTSW 3 90464894 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- TCTCTTAGTCCTCAGAGCACAC -3'
(R):5'- TACAGCCTCTGTAACAAGGC -3'

Sequencing Primer
(F):5'- GCCCCAGACCTACCTTATAGTATG -3'
(R):5'- GGCCCTCTCAAAGGTCAAATG -3'
Posted On2017-10-20