Incidental Mutation 'R6238:Pcdha9'
ID505087
Institutional Source Beutler Lab
Gene Symbol Pcdha9
Ensembl Gene ENSMUSG00000103770
Gene Nameprotocadherin alpha 9
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.758) question?
Stock #R6238 (G1)
Quality Score225.009
Status Validated
Chromosome18
Chromosomal Location36997880-37187657 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 36998975 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 366 (V366I)
Ref Sequence ENSEMBL: ENSMUSP00000111323 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070797] [ENSMUST00000115659] [ENSMUST00000115661] [ENSMUST00000115662] [ENSMUST00000192168] [ENSMUST00000192295] [ENSMUST00000192503] [ENSMUST00000192512] [ENSMUST00000192631] [ENSMUST00000193389] [ENSMUST00000193777] [ENSMUST00000194751] [ENSMUST00000194544] [ENSMUST00000193839] [ENSMUST00000195590] [ENSMUST00000194038]
Predicted Effect probably benign
Transcript: ENSMUST00000070797
SMART Domains Protein: ENSMUSP00000068828
Gene: ENSMUSG00000103442

DomainStartEndE-ValueType
CA 22 132 3.09e-2 SMART
CA 156 241 6.14e-20 SMART
CA 265 349 3.92e-27 SMART
CA 373 454 4.94e-24 SMART
CA 478 564 1e-24 SMART
CA 592 672 4.55e-14 SMART
transmembrane domain 694 716 N/A INTRINSIC
Pfam:Cadherin_tail 797 931 5.3e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115659
AA Change: V366I

PolyPhen 2 Score 0.434 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000111323
Gene: ENSMUSG00000103770
AA Change: V366I

DomainStartEndE-ValueType
low complexity region 44 51 N/A INTRINSIC
CA 75 161 2.46e-2 SMART
CA 185 270 8.1e-20 SMART
CA 294 378 1.69e-22 SMART
CA 402 483 1.52e-24 SMART
CA 507 593 5.68e-24 SMART
CA 624 705 6.69e-12 SMART
transmembrane domain 727 749 N/A INTRINSIC
Pfam:Cadherin_tail 828 962 5.6e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115661
SMART Domains Protein: ENSMUSP00000111325
Gene: ENSMUSG00000103458

DomainStartEndE-ValueType
CA 20 131 5.3e-2 SMART
CA 155 240 1.51e-19 SMART
CA 264 348 7.6e-25 SMART
CA 372 453 1.42e-24 SMART
CA 477 563 1.42e-24 SMART
CA 594 674 4.12e-12 SMART
low complexity region 706 721 N/A INTRINSIC
Pfam:Cadherin_tail 796 930 3.9e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115662
SMART Domains Protein: ENSMUSP00000111326
Gene: ENSMUSG00000104148

DomainStartEndE-ValueType
CA 45 131 6.34e-2 SMART
CA 155 240 2.98e-18 SMART
CA 264 348 2.17e-29 SMART
CA 372 453 2.84e-24 SMART
CA 477 563 5.02e-25 SMART
CA 594 675 8.16e-16 SMART
transmembrane domain 695 717 N/A INTRINSIC
low complexity region 916 940 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000192168
SMART Domains Protein: ENSMUSP00000142293
Gene: ENSMUSG00000103092

DomainStartEndE-ValueType
CA 21 131 2.2e-2 SMART
CA 155 240 2.05e-21 SMART
CA 264 348 8.81e-21 SMART
CA 372 453 2.01e-24 SMART
CA 477 563 1.42e-24 SMART
CA 591 673 1.63e-15 SMART
transmembrane domain 693 715 N/A INTRINSIC
low complexity region 902 926 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000192295
SMART Domains Protein: ENSMUSP00000142103
Gene: ENSMUSG00000104252

DomainStartEndE-ValueType
CA 20 131 5.3e-2 SMART
CA 155 240 1.51e-19 SMART
CA 264 348 7.6e-25 SMART
CA 372 453 1.42e-24 SMART
CA 477 568 5.38e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000192503
SMART Domains Protein: ENSMUSP00000141989
Gene: ENSMUSG00000102312

DomainStartEndE-ValueType
low complexity region 11 17 N/A INTRINSIC
CA 42 128 3.78e-2 SMART
CA 152 237 8.94e-22 SMART
CA 261 345 3.74e-24 SMART
CA 369 450 1.09e-25 SMART
CA 474 560 1.42e-24 SMART
CA 588 670 2.96e-13 SMART
transmembrane domain 692 714 N/A INTRINSIC
low complexity region 910 934 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000192512
SMART Domains Protein: ENSMUSP00000141408
Gene: ENSMUSG00000104252

DomainStartEndE-ValueType
CA 20 131 5.3e-2 SMART
CA 155 240 1.51e-19 SMART
CA 264 348 7.6e-25 SMART
CA 372 453 1.42e-24 SMART
CA 477 563 1.42e-24 SMART
CA 594 674 4.12e-12 SMART
low complexity region 706 721 N/A INTRINSIC
low complexity region 915 939 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000192631
SMART Domains Protein: ENSMUSP00000142156
Gene: ENSMUSG00000104318

DomainStartEndE-ValueType
CA 21 131 2.58e-2 SMART
CA 155 240 4.27e-19 SMART
CA 264 348 1.42e-24 SMART
CA 372 453 9.36e-25 SMART
CA 477 563 1.42e-24 SMART
CA 594 671 4.03e-6 SMART
transmembrane domain 696 718 N/A INTRINSIC
low complexity region 905 929 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000193389
SMART Domains Protein: ENSMUSP00000141459
Gene: ENSMUSG00000103707

DomainStartEndE-ValueType
CA 21 131 5.67e-2 SMART
CA 155 240 4.72e-21 SMART
CA 264 348 1.9e-25 SMART
CA 372 453 3.31e-25 SMART
CA 477 563 1.42e-24 SMART
CA 594 676 5.91e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000193777
SMART Domains Protein: ENSMUSP00000141587
Gene: ENSMUSG00000103707

DomainStartEndE-ValueType
CA 21 131 5.67e-2 SMART
CA 155 240 4.72e-21 SMART
CA 264 348 1.9e-25 SMART
CA 372 453 3.31e-25 SMART
CA 477 563 1.42e-24 SMART
CA 594 676 5.91e-13 SMART
low complexity region 914 938 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000194751
SMART Domains Protein: ENSMUSP00000142285
Gene: ENSMUSG00000103707

DomainStartEndE-ValueType
low complexity region 15 21 N/A INTRINSIC
Pfam:Cadherin_2 29 112 4.5e-32 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000194544
SMART Domains Protein: ENSMUSP00000141847
Gene: ENSMUSG00000102836

DomainStartEndE-ValueType
Blast:CA 18 66 5e-20 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000193984
Predicted Effect probably benign
Transcript: ENSMUST00000193839
SMART Domains Protein: ENSMUSP00000142308
Gene: ENSMUSG00000103442

DomainStartEndE-ValueType
CA 22 132 3.09e-2 SMART
CA 156 241 6.14e-20 SMART
CA 265 349 3.92e-27 SMART
CA 373 454 4.94e-24 SMART
CA 478 564 1e-24 SMART
CA 592 672 4.55e-14 SMART
transmembrane domain 694 716 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000195590
SMART Domains Protein: ENSMUSP00000141355
Gene: ENSMUSG00000104148

DomainStartEndE-ValueType
CA 45 131 6.34e-2 SMART
CA 155 240 2.98e-18 SMART
CA 264 348 2.17e-29 SMART
CA 372 453 2.84e-24 SMART
CA 477 563 5.02e-25 SMART
CA 594 675 8.16e-16 SMART
transmembrane domain 695 717 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000194038
SMART Domains Protein: ENSMUSP00000142159
Gene: ENSMUSG00000103800

DomainStartEndE-ValueType
CA 20 131 6.34e-2 SMART
CA 155 240 4.27e-19 SMART
CA 264 348 2.04e-25 SMART
CA 372 453 2.84e-24 SMART
CA 477 563 9.88e-24 SMART
CA 594 676 8.62e-15 SMART
transmembrane domain 699 721 N/A INTRINSIC
low complexity region 914 938 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.8%
Validation Efficiency 100% (62/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the protocadherin alpha gene cluster, one of three related gene clusters tandemly linked on chromosome five that demonstrate an unusual genomic organization similar to that of B-cell and T-cell receptor gene clusters. The alpha gene cluster is composed of 15 cadherin superfamily genes related to the mouse CNR genes and consists of 13 highly similar and 2 more distantly related coding sequences. The tandem array of 15 N-terminal exons, or variable exons, are followed by downstream C-terminal exons, or constant exons, which are shared by all genes in the cluster. The large, uninterrupted N-terminal exons each encode six cadherin ectodomains while the C-terminal exons encode the cytoplasmic domain. These neural cadherin-like cell adhesion proteins are integral plasma membrane proteins that most likely play a critical role in the establishment and function of specific cell-cell connections in the brain. Alternative splicing has been observed and additional variants have been suggested but their full-length nature has yet to be determined. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610028H24Rik A C 10: 76,449,262 T2P possibly damaging Het
2610042L04Rik A G 14: 4,348,962 N41S probably damaging Het
4933402N03Rik T C 7: 131,146,134 D43G probably benign Het
Adcy10 C A 1: 165,575,728 Y1598* probably null Het
Adgrv1 G A 13: 81,466,283 T3997M probably benign Het
Amfr A C 8: 94,000,364 F74V probably damaging Het
Ankrd13a T C 5: 114,786,726 Y91H probably benign Het
Baiap3 A G 17: 25,245,758 S767P probably benign Het
Car12 C T 9: 66,753,726 T124I probably damaging Het
Casp9 G T 4: 141,807,137 G286V probably damaging Het
Cc2d2a T A 5: 43,671,235 D18E probably benign Het
Cdc27 T C 11: 104,528,444 N221D probably damaging Het
Cebpz A G 17: 78,936,910 S41P possibly damaging Het
Cenpo T A 12: 4,231,968 S10C possibly damaging Het
Chid1 A G 7: 141,496,136 V368A probably benign Het
Clca1 C A 3: 145,008,955 V634L probably benign Het
Cmtr1 A G 17: 29,682,148 D683G probably damaging Het
Cpsf3 G T 12: 21,300,162 R294L probably damaging Het
Ddrgk1 G A 2: 130,654,679 T255M possibly damaging Het
Dennd6a T A 14: 26,616,658 probably null Het
Dnah10 A G 5: 124,743,679 R526G probably damaging Het
Dock3 G A 9: 106,912,948 T1484I probably benign Het
Efcab10 T C 12: 33,398,434 Y89H probably damaging Het
Etl4 T A 2: 20,801,568 D1200E probably damaging Het
Fbn1 T A 2: 125,324,945 D2017V probably damaging Het
Ftmt G A 18: 52,332,235 V208M probably damaging Het
Fzd10 T C 5: 128,602,931 Y572H probably damaging Het
Gcc1 T C 6: 28,420,743 K39E probably damaging Het
Hydin A G 8: 110,392,111 probably null Het
Lif A G 11: 4,268,940 E73G possibly damaging Het
Lrtm1 C A 14: 29,027,671 Q357K probably benign Het
Mef2d T A 3: 88,159,545 L205Q probably damaging Het
Naalad2 T A 9: 18,385,065 E96D probably damaging Het
Nbas T C 12: 13,482,595 I1768T probably benign Het
Nodal T C 10: 61,423,479 S232P probably damaging Het
Olfr598 A T 7: 103,328,908 I141F possibly damaging Het
Olfr876 A G 9: 37,804,021 T37A probably benign Het
Parl G A 16: 20,302,213 R39C possibly damaging Het
Pdzd8 A G 19: 59,300,562 V802A probably benign Het
Plcl2 T C 17: 50,606,845 V294A probably damaging Het
Plxna2 T A 1: 194,790,196 S1083T probably benign Het
Polr2a G T 11: 69,747,221 L141I possibly damaging Het
Ptpre C A 7: 135,671,180 R468S probably damaging Het
Raet1e T A 10: 22,180,871 N115K probably benign Het
Rfx8 C A 1: 39,670,394 S491I probably damaging Het
Rpe T A 1: 66,701,648 L48* probably null Het
Skint5 A T 4: 113,942,867 probably null Het
Spata24 C A 18: 35,660,336 S111I possibly damaging Het
Suz12 G C 11: 80,002,180 probably benign Het
Taf4 T A 2: 179,932,039 I679F probably damaging Het
Tlr1 G T 5: 64,927,129 P35Q possibly damaging Het
Tonsl T C 15: 76,636,218 probably null Het
Tsen54 G A 11: 115,820,687 R310H probably benign Het
Ttc7b A G 12: 100,495,422 S99P probably benign Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Uhmk1 T A 1: 170,199,994 N378I probably damaging Het
Vmn2r107 A G 17: 20,345,587 T55A probably benign Het
Vmn2r74 C T 7: 85,952,072 C786Y probably damaging Het
Wdr20rt C T 12: 65,226,190 probably benign Het
Zfand2a T A 5: 139,481,991 H42L probably damaging Het
Zfp990 T A 4: 145,537,913 C494S probably damaging Het
Zkscan4 A T 13: 21,484,587 R403W possibly damaging Het
Other mutations in Pcdha9
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0761:Pcdha9 UTSW 18 36999963 nonsense probably null
R2985:Pcdha9 UTSW 18 36998202 missense possibly damaging 0.88
R3926:Pcdha9 UTSW 18 36999412 missense probably damaging 1.00
R4049:Pcdha9 UTSW 18 36997942 missense probably benign 0.16
R4409:Pcdha9 UTSW 18 36999145 missense probably benign 0.12
R4816:Pcdha9 UTSW 18 36999458 missense probably damaging 1.00
R4905:Pcdha9 UTSW 18 36998892 missense probably damaging 0.96
R4991:Pcdha9 UTSW 18 36998345 missense probably damaging 0.99
R5484:Pcdha9 UTSW 18 36998103 missense probably damaging 1.00
R5487:Pcdha9 UTSW 18 36999650 missense probably damaging 1.00
R5617:Pcdha9 UTSW 18 36998816 missense probably benign 0.03
R5637:Pcdha9 UTSW 18 36998373 missense probably benign 0.00
R5694:Pcdha9 UTSW 18 36998372 missense probably benign 0.00
R5975:Pcdha9 UTSW 18 36999111 missense probably benign 0.00
R6089:Pcdha9 UTSW 18 36998498 missense probably benign 0.00
R6176:Pcdha9 UTSW 18 36998931 missense probably benign 0.24
R6220:Pcdha9 UTSW 18 36998478 missense probably damaging 1.00
R6391:Pcdha9 UTSW 18 36997919 missense probably benign 0.12
R6622:Pcdha9 UTSW 18 36998654 missense possibly damaging 0.84
R6720:Pcdha9 UTSW 18 36998069 missense probably damaging 0.99
R7239:Pcdha9 UTSW 18 36998498 missense probably benign 0.06
R7624:Pcdha9 UTSW 18 36999796 nonsense probably null
R7721:Pcdha9 UTSW 18 36999636 missense probably benign
R8211:Pcdha9 UTSW 18 36998859 missense possibly damaging 0.56
R8483:Pcdha9 UTSW 18 36998583 missense probably benign 0.01
R8778:Pcdha9 UTSW 18 36999191 missense possibly damaging 0.65
R8946:Pcdha9 UTSW 18 36998493 missense possibly damaging 0.92
R8963:Pcdha9 UTSW 18 36998697 missense probably benign 0.43
Z1177:Pcdha9 UTSW 18 36998214 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGCTACTGACTCAGATGAAGG -3'
(R):5'- ACCAACTTGAAGGGGACATG -3'

Sequencing Primer
(F):5'- CTACTGACTCAGATGAAGGAATAAAC -3'
(R):5'- CAACTTGAAGGGGACATGGTTAGTC -3'
Posted On2018-02-28