Incidental Mutation 'R6305:Bcl9'
ID509578
Institutional Source Beutler Lab
Gene Symbol Bcl9
Ensembl Gene ENSMUSG00000038256
Gene NameB cell CLL/lymphoma 9
Synonyms8030475K17Rik, A330041G23Rik, 2610202E01Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.889) question?
Stock #R6305 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location97203662-97297917 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 97205938 bp
ZygosityHeterozygous
Amino Acid Change Proline to Leucine at position 1067 (P1067L)
Ref Sequence ENSEMBL: ENSMUSP00000131692 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046521] [ENSMUST00000166341]
Predicted Effect possibly damaging
Transcript: ENSMUST00000046521
AA Change: P1067L

PolyPhen 2 Score 0.725 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000046152
Gene: ENSMUSG00000038256
AA Change: P1067L

DomainStartEndE-ValueType
low complexity region 49 63 N/A INTRINSIC
low complexity region 86 98 N/A INTRINSIC
low complexity region 144 157 N/A INTRINSIC
PDB:2VP7|B 174 205 4e-13 PDB
low complexity region 229 247 N/A INTRINSIC
low complexity region 255 273 N/A INTRINSIC
low complexity region 321 342 N/A INTRINSIC
Pfam:BCL9 350 389 3.1e-24 PFAM
low complexity region 481 494 N/A INTRINSIC
low complexity region 506 517 N/A INTRINSIC
low complexity region 817 835 N/A INTRINSIC
low complexity region 891 902 N/A INTRINSIC
low complexity region 985 1001 N/A INTRINSIC
low complexity region 1032 1044 N/A INTRINSIC
low complexity region 1135 1153 N/A INTRINSIC
low complexity region 1156 1177 N/A INTRINSIC
low complexity region 1257 1268 N/A INTRINSIC
low complexity region 1281 1299 N/A INTRINSIC
low complexity region 1371 1391 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132266
Predicted Effect possibly damaging
Transcript: ENSMUST00000166341
AA Change: P1067L

PolyPhen 2 Score 0.725 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000131692
Gene: ENSMUSG00000038256
AA Change: P1067L

DomainStartEndE-ValueType
low complexity region 49 63 N/A INTRINSIC
low complexity region 86 98 N/A INTRINSIC
low complexity region 144 157 N/A INTRINSIC
PDB:2VP7|B 174 205 4e-13 PDB
low complexity region 229 247 N/A INTRINSIC
low complexity region 255 273 N/A INTRINSIC
low complexity region 321 342 N/A INTRINSIC
Pfam:BCL9 350 388 5.2e-22 PFAM
low complexity region 481 494 N/A INTRINSIC
low complexity region 506 517 N/A INTRINSIC
low complexity region 817 835 N/A INTRINSIC
low complexity region 891 902 N/A INTRINSIC
low complexity region 985 1001 N/A INTRINSIC
low complexity region 1032 1044 N/A INTRINSIC
low complexity region 1135 1153 N/A INTRINSIC
low complexity region 1156 1177 N/A INTRINSIC
low complexity region 1257 1268 N/A INTRINSIC
low complexity region 1281 1299 N/A INTRINSIC
low complexity region 1371 1391 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.5%
Validation Efficiency 97% (61/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] BCL9 is associated with B-cell acute lymphoblastic leukemia. It may be a target of translocation in B-cell malignancies with abnormalities of 1q21. Its function is unknown. The overexpression of BCL9 may be of pathogenic significance in B-cell malignancies. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice carrying homozygous floxed Bcl9 and Bcl9l alleles, inactivated in muscle cells, exhibit impaired muscle regeneration due to increased apoptosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik T C 3: 138,067,980 S977P probably damaging Het
Abraxas2 G A 7: 132,874,965 A145T probably damaging Het
Adcy6 T A 15: 98,598,645 I550L probably benign Het
Agbl3 G A 6: 34,782,210 D19N unknown Het
Ankdd1a C T 9: 65,508,061 A227T possibly damaging Het
Arhgap39 T A 15: 76,737,702 D233V probably benign Het
C130060K24Rik A T 6: 65,454,991 M293L probably benign Het
Casd1 C T 6: 4,641,892 T723I probably damaging Het
Cd209g T A 8: 4,136,809 I118N probably benign Het
Cdh24 A T 14: 54,632,356 D701E possibly damaging Het
Chd9 C T 8: 91,030,546 P1858S possibly damaging Het
Csnk1g3 T A 18: 53,932,312 Y322* probably null Het
Cyp2f2 G A 7: 27,129,224 R173H probably damaging Het
D130043K22Rik T C 13: 24,885,685 F909S probably damaging Het
Dll4 T A 2: 119,330,657 S299T probably benign Het
Dnase1l1 C T X: 74,277,038 probably null Homo
Dsg4 T A 18: 20,449,790 Y162N probably damaging Het
Enpp1 T C 10: 24,641,882 Y882C probably damaging Het
Fam129a T C 1: 151,695,718 L248P probably damaging Het
Fbxw7 T A 3: 84,976,323 N520K probably damaging Het
Galc C T 12: 98,259,290 A14T possibly damaging Het
Gm11492 C T 11: 87,567,319 T173M probably benign Het
Grm7 G A 6: 111,358,665 R679Q probably damaging Het
Hnrnpdl T C 5: 100,038,658 probably benign Het
Il12a A T 3: 68,694,178 K77N possibly damaging Het
Il17rd C T 14: 27,095,942 S196L possibly damaging Het
Kcnv2 T C 19: 27,323,837 F363L probably benign Het
Lair1 A G 7: 4,010,728 probably null Het
Lrit3 G A 3: 129,800,460 T156I probably damaging Het
Me2 T A 18: 73,791,844 R267S probably benign Het
Mga T C 2: 119,947,698 V1908A probably benign Het
Mylk3 T A 8: 85,350,419 I463F probably damaging Het
Neb G A 2: 52,251,763 R75* probably null Het
Olfr1080 A G 2: 86,553,495 S210P possibly damaging Het
Olfr339 T A 2: 36,421,622 S75T probably damaging Het
Olfr469 T G 7: 107,822,657 T271P probably benign Het
Olfr516 C T 7: 108,845,554 G152D possibly damaging Het
Olfr883 ATTGCTGTTT ATTGCTGTTTGCTGTTT 9: 38,026,540 probably null Het
Olfr883 TG TGGTGTTGG 9: 38,026,542 probably null Het
Pfas A G 11: 69,001,197 S162P possibly damaging Het
Pip5k1c T A 10: 81,315,934 V654E probably benign Het
Plxdc1 C A 11: 97,938,590 C318F probably damaging Het
Rbm8a2 T C 1: 175,978,746 D55G probably benign Het
Rexo5 A T 7: 119,828,125 K419N probably damaging Het
Slc13a2 CGTTATCTGT CGT 11: 78,403,480 probably benign Het
Slc24a4 C A 12: 102,222,101 T151K possibly damaging Het
Slc6a15 A T 10: 103,389,170 I40F probably benign Het
Slc6a21 T C 7: 45,280,604 V172A possibly damaging Het
Thrap3 A G 4: 126,180,807 probably benign Het
Tm9sf3 A G 19: 41,245,442 probably null Het
Trp53 A T 11: 69,588,707 H211L probably damaging Het
Ttc21b A T 2: 66,188,270 N1264K probably damaging Het
Vmn1r120 A T 7: 21,053,606 V60E possibly damaging Het
Ylpm1 A G 12: 85,030,545 E890G probably damaging Het
Zfp647 G A 15: 76,912,085 P125L probably damaging Het
Zfp934 T C 13: 62,518,556 Y102C probably damaging Het
Other mutations in Bcl9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00553:Bcl9 APN 3 97207202 missense probably damaging 1.00
IGL00817:Bcl9 APN 3 97205144 missense probably damaging 0.97
IGL01609:Bcl9 APN 3 97208975 missense probably benign 0.23
IGL02245:Bcl9 APN 3 97208693 missense probably damaging 1.00
IGL02385:Bcl9 APN 3 97209278 missense probably benign 0.01
IGL02534:Bcl9 APN 3 97215229 missense probably damaging 1.00
IGL02663:Bcl9 APN 3 97205332 missense probably damaging 1.00
IGL02705:Bcl9 APN 3 97204865 missense possibly damaging 0.94
IGL02884:Bcl9 APN 3 97210052 missense probably damaging 1.00
IGL03345:Bcl9 APN 3 97209192 missense probably benign
R0312:Bcl9 UTSW 3 97209411 missense probably benign 0.27
R0602:Bcl9 UTSW 3 97205786 missense probably benign 0.00
R0627:Bcl9 UTSW 3 97205473 missense probably damaging 1.00
R0644:Bcl9 UTSW 3 97210497 missense probably benign
R1342:Bcl9 UTSW 3 97205726 missense possibly damaging 0.93
R1836:Bcl9 UTSW 3 97205870 missense probably damaging 0.97
R1886:Bcl9 UTSW 3 97215397 missense probably benign 0.04
R1931:Bcl9 UTSW 3 97205144 missense probably damaging 0.97
R1972:Bcl9 UTSW 3 97207202 missense probably damaging 1.00
R1984:Bcl9 UTSW 3 97213734 missense probably damaging 0.98
R2119:Bcl9 UTSW 3 97208915 missense probably benign 0.04
R2924:Bcl9 UTSW 3 97209753 missense probably benign 0.00
R3081:Bcl9 UTSW 3 97205673 missense possibly damaging 0.82
R3851:Bcl9 UTSW 3 97209653 missense probably damaging 0.99
R4182:Bcl9 UTSW 3 97213683 critical splice donor site probably null
R4196:Bcl9 UTSW 3 97216368 utr 5 prime probably benign
R4209:Bcl9 UTSW 3 97209953 missense probably damaging 1.00
R5082:Bcl9 UTSW 3 97209902 missense probably damaging 0.97
R5440:Bcl9 UTSW 3 97210565 missense probably benign
R5770:Bcl9 UTSW 3 97215175 missense probably benign
R5863:Bcl9 UTSW 3 97210350 missense probably benign
R5891:Bcl9 UTSW 3 97208888 missense probably damaging 1.00
R6086:Bcl9 UTSW 3 97205524 missense possibly damaging 0.73
R6626:Bcl9 UTSW 3 97215396 missense probably benign 0.00
R7198:Bcl9 UTSW 3 97205195 missense possibly damaging 0.87
R7198:Bcl9 UTSW 3 97208867 missense probably damaging 0.99
R7548:Bcl9 UTSW 3 97205893 missense probably damaging 1.00
R7897:Bcl9 UTSW 3 97205251 missense possibly damaging 0.92
R7980:Bcl9 UTSW 3 97205251 missense possibly damaging 0.92
X0011:Bcl9 UTSW 3 97205974 missense probably benign 0.05
Z1088:Bcl9 UTSW 3 97210641 missense possibly damaging 0.50
Predicted Primers PCR Primer
(F):5'- TGAGGTACCATTGGAGGCTC -3'
(R):5'- ACTGTGTGCCTCCAAGAGTG -3'

Sequencing Primer
(F):5'- TACCATTGGAGGCTCCTGGG -3'
(R):5'- GTCACAAACTTTTGGTGACAGCG -3'
Posted On2018-04-02