Incidental Mutation 'R6305:Cyp2f2'
ID509588
Institutional Source Beutler Lab
Gene Symbol Cyp2f2
Ensembl Gene ENSMUSG00000052974
Gene Namecytochrome P450, family 2, subfamily f, polypeptide 2
SynonymsCyp2f
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.156) question?
Stock #R6305 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location27119909-27133660 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 27129224 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 173 (R173H)
Ref Sequence ENSEMBL: ENSMUSP00000003100 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003100] [ENSMUST00000206552]
Predicted Effect probably damaging
Transcript: ENSMUST00000003100
AA Change: R173H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000003100
Gene: ENSMUSG00000052974
AA Change: R173H

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Pfam:p450 31 488 3.7e-152 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133841
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153562
Predicted Effect probably benign
Transcript: ENSMUST00000206552
AA Change: R97H

PolyPhen 2 Score 0.177 (Sensitivity: 0.92; Specificity: 0.87)
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.5%
Validation Efficiency 97% (61/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. This protein localizes to the endoplasmic reticulum and is known to dehydrogenate 3-methylindole, an endogenous toxin derived from the fermentation of tryptophan, as well as xenobiotic substrates such as naphthalene and ethoxycoumarin. This gene is part of a large cluster of cytochrome P450 genes from the CYP2A, CYP2B and CYP2F subfamilies on chromosome 19q. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit resistance to napthalene-induced toxicity in the lungs. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik T C 3: 138,067,980 S977P probably damaging Het
Abraxas2 G A 7: 132,874,965 A145T probably damaging Het
Adcy6 T A 15: 98,598,645 I550L probably benign Het
Agbl3 G A 6: 34,782,210 D19N unknown Het
Ankdd1a C T 9: 65,508,061 A227T possibly damaging Het
Arhgap39 T A 15: 76,737,702 D233V probably benign Het
Bcl9 G A 3: 97,205,938 P1067L possibly damaging Het
C130060K24Rik A T 6: 65,454,991 M293L probably benign Het
Casd1 C T 6: 4,641,892 T723I probably damaging Het
Cd209g T A 8: 4,136,809 I118N probably benign Het
Cdh24 A T 14: 54,632,356 D701E possibly damaging Het
Chd9 C T 8: 91,030,546 P1858S possibly damaging Het
Csnk1g3 T A 18: 53,932,312 Y322* probably null Het
D130043K22Rik T C 13: 24,885,685 F909S probably damaging Het
Dll4 T A 2: 119,330,657 S299T probably benign Het
Dnase1l1 C T X: 74,277,038 probably null Homo
Dsg4 T A 18: 20,449,790 Y162N probably damaging Het
Enpp1 T C 10: 24,641,882 Y882C probably damaging Het
Fam129a T C 1: 151,695,718 L248P probably damaging Het
Fbxw7 T A 3: 84,976,323 N520K probably damaging Het
Galc C T 12: 98,259,290 A14T possibly damaging Het
Gm11492 C T 11: 87,567,319 T173M probably benign Het
Grm7 G A 6: 111,358,665 R679Q probably damaging Het
Hnrnpdl T C 5: 100,038,658 probably benign Het
Il12a A T 3: 68,694,178 K77N possibly damaging Het
Il17rd C T 14: 27,095,942 S196L possibly damaging Het
Kcnv2 T C 19: 27,323,837 F363L probably benign Het
Lair1 A G 7: 4,010,728 probably null Het
Lrit3 G A 3: 129,800,460 T156I probably damaging Het
Me2 T A 18: 73,791,844 R267S probably benign Het
Mga T C 2: 119,947,698 V1908A probably benign Het
Mylk3 T A 8: 85,350,419 I463F probably damaging Het
Neb G A 2: 52,251,763 R75* probably null Het
Olfr1080 A G 2: 86,553,495 S210P possibly damaging Het
Olfr339 T A 2: 36,421,622 S75T probably damaging Het
Olfr469 T G 7: 107,822,657 T271P probably benign Het
Olfr516 C T 7: 108,845,554 G152D possibly damaging Het
Olfr883 ATTGCTGTTT ATTGCTGTTTGCTGTTT 9: 38,026,540 probably null Het
Olfr883 TG TGGTGTTGG 9: 38,026,542 probably null Het
Pfas A G 11: 69,001,197 S162P possibly damaging Het
Pip5k1c T A 10: 81,315,934 V654E probably benign Het
Plxdc1 C A 11: 97,938,590 C318F probably damaging Het
Rbm8a2 T C 1: 175,978,746 D55G probably benign Het
Rexo5 A T 7: 119,828,125 K419N probably damaging Het
Slc13a2 CGTTATCTGT CGT 11: 78,403,480 probably benign Het
Slc24a4 C A 12: 102,222,101 T151K possibly damaging Het
Slc6a15 A T 10: 103,389,170 I40F probably benign Het
Slc6a21 T C 7: 45,280,604 V172A possibly damaging Het
Thrap3 A G 4: 126,180,807 probably benign Het
Tm9sf3 A G 19: 41,245,442 probably null Het
Trp53 A T 11: 69,588,707 H211L probably damaging Het
Ttc21b A T 2: 66,188,270 N1264K probably damaging Het
Vmn1r120 A T 7: 21,053,606 V60E possibly damaging Het
Ylpm1 A G 12: 85,030,545 E890G probably damaging Het
Zfp647 G A 15: 76,912,085 P125L probably damaging Het
Zfp934 T C 13: 62,518,556 Y102C probably damaging Het
Other mutations in Cyp2f2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00911:Cyp2f2 APN 7 27121929 missense probably damaging 0.98
IGL00953:Cyp2f2 APN 7 27129817 missense possibly damaging 0.47
IGL01781:Cyp2f2 APN 7 27130421 missense probably benign 0.20
IGL02817:Cyp2f2 APN 7 27129315 missense probably damaging 1.00
IGL03027:Cyp2f2 APN 7 27132571 missense possibly damaging 0.95
R0464:Cyp2f2 UTSW 7 27132537 missense probably benign 0.00
R1481:Cyp2f2 UTSW 7 27121877 missense probably benign 0.00
R1635:Cyp2f2 UTSW 7 27129724 missense probably benign 0.11
R1826:Cyp2f2 UTSW 7 27132562 missense probably damaging 1.00
R1989:Cyp2f2 UTSW 7 27129203 missense probably damaging 1.00
R5098:Cyp2f2 UTSW 7 27129879 missense possibly damaging 0.52
R6472:Cyp2f2 UTSW 7 27129224 missense probably damaging 1.00
R7132:Cyp2f2 UTSW 7 27132568 missense probably benign 0.00
R7599:Cyp2f2 UTSW 7 27131359 critical splice donor site probably null
R7814:Cyp2f2 UTSW 7 27129253 missense probably benign 0.00
R7823:Cyp2f2 UTSW 7 27129253 missense probably benign 0.00
R7824:Cyp2f2 UTSW 7 27129253 missense probably benign 0.00
R7825:Cyp2f2 UTSW 7 27129253 missense probably benign 0.00
X0064:Cyp2f2 UTSW 7 27133284 missense probably damaging 1.00
Z1177:Cyp2f2 UTSW 7 27121907 missense possibly damaging 0.52
Predicted Primers PCR Primer
(F):5'- GAGTTTTGTTGTACATGACATTGCC -3'
(R):5'- TGGACCCATGATCCCATCTG -3'

Sequencing Primer
(F):5'- GGCCTGTCATATTGCACATTG -3'
(R):5'- CATCTGGTTGACCTCCGAGTG -3'
Posted On2018-04-02