Incidental Mutation 'R6305:Cdh24'
ID509619
Institutional Source Beutler Lab
Gene Symbol Cdh24
Ensembl Gene ENSMUSG00000059674
Gene Namecadherin-like 24
SynonymsEY-cadherin, cadherin 14-like, 1700040A22Rik, ENSMUSG00000022188
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.161) question?
Stock #R6305 (G1)
Quality Score165.009
Status Validated
Chromosome14
Chromosomal Location54631231-54641364 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 54632356 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 701 (D701E)
Ref Sequence ENSEMBL: ENSMUSP00000066005 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067784] [ENSMUST00000097177] [ENSMUST00000173083] [ENSMUST00000227124]
Predicted Effect possibly damaging
Transcript: ENSMUST00000067784
AA Change: D701E

PolyPhen 2 Score 0.617 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000066005
Gene: ENSMUSG00000059674
AA Change: D701E

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
CA 67 148 7.85e-18 SMART
CA 172 257 3.23e-28 SMART
CA 281 369 4.24e-14 SMART
CA 396 477 1.48e-22 SMART
Blast:CA 500 581 3e-31 BLAST
transmembrane domain 602 624 N/A INTRINSIC
Pfam:Cadherin_C 627 775 2e-48 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000097177
SMART Domains Protein: ENSMUSP00000132140
Gene: ENSMUSG00000072423

DomainStartEndE-ValueType
Pfam:Proteasome 46 228 3.9e-41 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000173083
AA Change: I9F
SMART Domains Protein: ENSMUSP00000133514
Gene: ENSMUSG00000092443
AA Change: I9F

DomainStartEndE-ValueType
low complexity region 72 83 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000227124
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.5%
Validation Efficiency 97% (61/63)
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik T C 3: 138,067,980 S977P probably damaging Het
Abraxas2 G A 7: 132,874,965 A145T probably damaging Het
Adcy6 T A 15: 98,598,645 I550L probably benign Het
Agbl3 G A 6: 34,782,210 D19N unknown Het
Ankdd1a C T 9: 65,508,061 A227T possibly damaging Het
Arhgap39 T A 15: 76,737,702 D233V probably benign Het
Bcl9 G A 3: 97,205,938 P1067L possibly damaging Het
C130060K24Rik A T 6: 65,454,991 M293L probably benign Het
Casd1 C T 6: 4,641,892 T723I probably damaging Het
Cd209g T A 8: 4,136,809 I118N probably benign Het
Chd9 C T 8: 91,030,546 P1858S possibly damaging Het
Csnk1g3 T A 18: 53,932,312 Y322* probably null Het
Cyp2f2 G A 7: 27,129,224 R173H probably damaging Het
D130043K22Rik T C 13: 24,885,685 F909S probably damaging Het
Dll4 T A 2: 119,330,657 S299T probably benign Het
Dnase1l1 C T X: 74,277,038 probably null Homo
Dsg4 T A 18: 20,449,790 Y162N probably damaging Het
Enpp1 T C 10: 24,641,882 Y882C probably damaging Het
Fam129a T C 1: 151,695,718 L248P probably damaging Het
Fbxw7 T A 3: 84,976,323 N520K probably damaging Het
Galc C T 12: 98,259,290 A14T possibly damaging Het
Gm11492 C T 11: 87,567,319 T173M probably benign Het
Grm7 G A 6: 111,358,665 R679Q probably damaging Het
Hnrnpdl T C 5: 100,038,658 probably benign Het
Il12a A T 3: 68,694,178 K77N possibly damaging Het
Il17rd C T 14: 27,095,942 S196L possibly damaging Het
Kcnv2 T C 19: 27,323,837 F363L probably benign Het
Lair1 A G 7: 4,010,728 probably null Het
Lrit3 G A 3: 129,800,460 T156I probably damaging Het
Me2 T A 18: 73,791,844 R267S probably benign Het
Mga T C 2: 119,947,698 V1908A probably benign Het
Mylk3 T A 8: 85,350,419 I463F probably damaging Het
Neb G A 2: 52,251,763 R75* probably null Het
Olfr1080 A G 2: 86,553,495 S210P possibly damaging Het
Olfr339 T A 2: 36,421,622 S75T probably damaging Het
Olfr469 T G 7: 107,822,657 T271P probably benign Het
Olfr516 C T 7: 108,845,554 G152D possibly damaging Het
Olfr883 ATTGCTGTTT ATTGCTGTTTGCTGTTT 9: 38,026,540 probably null Het
Olfr883 TG TGGTGTTGG 9: 38,026,542 probably null Het
Pfas A G 11: 69,001,197 S162P possibly damaging Het
Pip5k1c T A 10: 81,315,934 V654E probably benign Het
Plxdc1 C A 11: 97,938,590 C318F probably damaging Het
Rbm8a2 T C 1: 175,978,746 D55G probably benign Het
Rexo5 A T 7: 119,828,125 K419N probably damaging Het
Slc13a2 CGTTATCTGT CGT 11: 78,403,480 probably benign Het
Slc24a4 C A 12: 102,222,101 T151K possibly damaging Het
Slc6a15 A T 10: 103,389,170 I40F probably benign Het
Slc6a21 T C 7: 45,280,604 V172A possibly damaging Het
Thrap3 A G 4: 126,180,807 probably benign Het
Tm9sf3 A G 19: 41,245,442 probably null Het
Trp53 A T 11: 69,588,707 H211L probably damaging Het
Ttc21b A T 2: 66,188,270 N1264K probably damaging Het
Vmn1r120 A T 7: 21,053,606 V60E possibly damaging Het
Ylpm1 A G 12: 85,030,545 E890G probably damaging Het
Zfp647 G A 15: 76,912,085 P125L probably damaging Het
Zfp934 T C 13: 62,518,556 Y102C probably damaging Het
Other mutations in Cdh24
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01362:Cdh24 APN 14 54638432 missense probably benign 0.01
IGL02597:Cdh24 APN 14 54633515 missense possibly damaging 0.55
R0088:Cdh24 UTSW 14 54633714 missense probably damaging 1.00
R0480:Cdh24 UTSW 14 54632597 missense probably benign 0.38
R0890:Cdh24 UTSW 14 54632594 missense probably benign 0.00
R1525:Cdh24 UTSW 14 54638589 missense probably damaging 1.00
R1591:Cdh24 UTSW 14 54636342 missense probably benign 0.19
R1727:Cdh24 UTSW 14 54638638 nonsense probably null
R3757:Cdh24 UTSW 14 54632180 missense possibly damaging 0.92
R4786:Cdh24 UTSW 14 54637550 missense possibly damaging 0.65
R4921:Cdh24 UTSW 14 54633215 missense probably damaging 1.00
R4929:Cdh24 UTSW 14 54633516 missense probably benign 0.00
R5116:Cdh24 UTSW 14 54636413 missense probably benign 0.34
R5589:Cdh24 UTSW 14 54637375 missense probably damaging 1.00
R5682:Cdh24 UTSW 14 54637348 missense probably damaging 1.00
R5774:Cdh24 UTSW 14 54639057 missense probably damaging 0.99
R7090:Cdh24 UTSW 14 54639507 missense probably damaging 1.00
R7186:Cdh24 UTSW 14 54633492 missense probably benign 0.03
R7361:Cdh24 UTSW 14 54638921 missense possibly damaging 0.74
R7488:Cdh24 UTSW 14 54632180 missense possibly damaging 0.92
R7623:Cdh24 UTSW 14 54638090 missense probably damaging 1.00
R7823:Cdh24 UTSW 14 54637418 missense probably damaging 1.00
R8019:Cdh24 UTSW 14 54638632 missense probably damaging 1.00
R8029:Cdh24 UTSW 14 54639399 missense probably damaging 1.00
R8070:Cdh24 UTSW 14 54632573 missense probably benign
Predicted Primers PCR Primer
(F):5'- ATACAGCTCTGCCAGAGTGC -3'
(R):5'- AGCCTTGATGGTACTGGAGG -3'

Sequencing Primer
(F):5'- TCTGCCAGAGTGCGGAAG -3'
(R):5'- AGGACGTCCGCGAGAACATC -3'
Posted On2018-04-02