Incidental Mutation 'R6396:Riox1'
ID516011
Institutional Source Beutler Lab
Gene Symbol Riox1
Ensembl Gene ENSMUSG00000046791
Gene Nameribosomal oxygenase 1
SynonymsNO66, 2410016O06Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.177) question?
Stock #R6396 (G1)
Quality Score163.009
Status Validated
Chromosome12
Chromosomal Location83950608-83952951 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 83951313 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Asparagine at position 208 (D208N)
Ref Sequence ENSEMBL: ENSMUSP00000057984 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053744] [ENSMUST00000164935]
Predicted Effect possibly damaging
Transcript: ENSMUST00000053744
AA Change: D208N

PolyPhen 2 Score 0.885 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000057984
Gene: ENSMUSG00000046791
AA Change: D208N

DomainStartEndE-ValueType
low complexity region 15 22 N/A INTRINSIC
low complexity region 44 65 N/A INTRINSIC
JmjC 266 394 5.07e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000164935
SMART Domains Protein: ENSMUSP00000129832
Gene: ENSMUSG00000090843

DomainStartEndE-ValueType
low complexity region 153 166 N/A INTRINSIC
low complexity region 261 272 N/A INTRINSIC
low complexity region 289 303 N/A INTRINSIC
low complexity region 533 548 N/A INTRINSIC
internal_repeat_1 577 711 2.78e-6 PROSPERO
Pfam:HEAT_2 776 890 1.8e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181399
SMART Domains Protein: ENSMUSP00000137697
Gene: ENSMUSG00000096953

DomainStartEndE-ValueType
low complexity region 1 19 N/A INTRINSIC
low complexity region 27 40 N/A INTRINSIC
low complexity region 47 60 N/A INTRINSIC
low complexity region 68 98 N/A INTRINSIC
low complexity region 117 161 N/A INTRINSIC
low complexity region 171 212 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220615
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221865
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222424
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223215
Meta Mutation Damage Score 0.0851 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 97.9%
Validation Efficiency 100% (36/36)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele activated in mesenchyme exhibit increased body length and weight, increased ossification with increased bone mass, bone mineral density, and volume, increased osteoblasts; and decrease osteoclasts. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810474O19Rik A G 6: 149,327,919 D821G probably damaging Het
Arhgap35 A T 7: 16,562,299 I947K probably damaging Het
B3galnt2 A T 13: 13,995,748 I447F probably damaging Het
Cacna2d3 C A 14: 29,396,565 V134L probably benign Het
Clcn4 C T 7: 7,294,025 G145S probably damaging Het
Cndp1 A T 18: 84,632,010 M186K probably benign Het
Cntn6 A G 6: 104,650,500 Y98C probably damaging Het
Ctsb T C 14: 63,138,101 V172A probably benign Het
Dnase1l1 C T X: 74,277,038 probably null Homo
Dyrk1a C A 16: 94,671,440 Q230K probably damaging Het
Ech1 C T 7: 28,830,338 probably null Het
Fam81b T A 13: 76,251,849 R97W probably damaging Het
Heatr1 A G 13: 12,406,097 E423G possibly damaging Het
Hydin A T 8: 110,506,889 K1786N probably damaging Het
Igf2r T C 17: 12,714,090 I848M probably benign Het
Igkv10-96 G A 6: 68,631,985 Q109* probably null Het
Mup6 T C 4: 60,004,837 I76T possibly damaging Het
Nmt2 A G 2: 3,314,701 R243G probably benign Het
Nsd1 G A 13: 55,238,789 G119D probably damaging Het
Olfr1218 A G 2: 89,055,297 I43T probably benign Het
Olfr1225 T G 2: 89,170,690 D174A probably damaging Het
Olfr51 A G 11: 51,007,485 H171R possibly damaging Het
Olfr613 C T 7: 103,552,681 Q299* probably null Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Pank3 T C 11: 35,778,689 V250A probably damaging Het
Pcdh10 A G 3: 45,380,060 I270V possibly damaging Het
Pnp2 T A 14: 50,963,159 V94E probably damaging Het
Prdm10 T C 9: 31,318,546 V86A possibly damaging Het
Rrp15 A G 1: 186,737,586 probably null Het
Skor1 G T 9: 63,144,950 P579Q probably damaging Het
Slc44a4 T A 17: 34,928,884 Y481* probably null Het
Smg7 A T 1: 152,848,600 V610E probably benign Het
Tlx1 A G 19: 45,156,052 Q71R probably damaging Het
Vmn2r27 A T 6: 124,224,166 Y277* probably null Het
Zswim2 T A 2: 83,923,718 R199S probably damaging Het
Other mutations in Riox1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01141:Riox1 APN 12 83951794 missense probably damaging 1.00
R1968:Riox1 UTSW 12 83951382 missense probably damaging 1.00
R2158:Riox1 UTSW 12 83950935 missense probably benign 0.00
R2395:Riox1 UTSW 12 83950644 start gained probably null
R5691:Riox1 UTSW 12 83951692 missense possibly damaging 0.54
R6968:Riox1 UTSW 12 83951373 missense probably damaging 0.98
R7322:Riox1 UTSW 12 83950668 unclassified probably benign
R7520:Riox1 UTSW 12 83951771 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AGGTACTGACGGAGCTGAAC -3'
(R):5'- TTCCAGTACCGTTTGCAGCAC -3'

Sequencing Primer
(F):5'- TGACGGAGCTGAACGGCATC -3'
(R):5'- GACTAGATGTCAGGGCCAACTC -3'
Posted On2018-05-04