Mutagenetix > Incidental Mutation

Incidental Mutation 'R7256:Zbbx'

564251

Institutional Source

Beutler Lab

Gene Symbol

Zbbx

Ensembl Gene

ENSMUSG00000034151

Gene Name

zinc finger, B-box domain containing

Synonyms

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.049) question?

Stock #

R7256 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

75037907-75165034 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 75039898 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Histidine to Glutamine at position 670 (H670Q)

Ref Sequence

ENSEMBL: ENSMUSP00000103407 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000039269] [ENSMUST00000107778]

AlphaFold

Q0P5X5

Predicted Effect

probably benign
Transcript: ENSMUST00000039269
AA Change: H665Q

PolyPhen 2 Score 0.024 (Sensitivity: 0.95; Specificity: 0.81)

SMART Domains

Protein: ENSMUSP00000043970
Gene: ENSMUSG00000034151
AA Change: H665Q

Domain	Start	End	E-Value	Type
Blast:BBOX	13	58	5e-22	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000107778
AA Change: H670Q

PolyPhen 2 Score 0.024 (Sensitivity: 0.95; Specificity: 0.81)

SMART Domains

Protein: ENSMUSP00000103407
Gene: ENSMUSG00000034151
AA Change: H670Q

Domain	Start	End	E-Value	Type
Blast:BBOX	13	58	5e-22	BLAST

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.0%

Validation Efficiency

99% (70/71)

Allele List at MGI

Other mutations in this stock

Total: 71 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adamts5	A	G	16: 85,863,035	Y790H	probably damaging	Het
Bend3	A	C	10: 43,493,671	S7R	probably benign	Het
Ccdc106	A	G	7: 5,060,326	T277A	probably damaging	Het
Ccdc162	G	A	10: 41,556,001	A1832V	probably damaging	Het
Ccser1	A	G	6: 61,311,867	E338G	probably benign	Het
Cd86	CA	CAA	16: 36,606,555		probably null	Het
Cecr2	T	C	6: 120,762,529	S1406P	probably benign	Het
Cep290	A	G	10: 100,546,498	T208A	probably damaging	Het
Cep85l	A	C	10: 53,296,255	C569W	probably damaging	Het
Ces5a	G	A	8: 93,499,526	T527I	probably benign	Het
Clca2	T	A	3: 145,090,847	I200F	probably damaging	Het
Cmas	G	A	6: 142,770,586	D251N	probably damaging	Het
Ctcfl	G	T	2: 173,118,475	A105E	probably benign	Het
Dclk2	C	T	3: 86,793,259	R638H	probably damaging	Het
Dctn6	A	T	8: 34,090,808	I170N	probably damaging	Het
Dnah2	T	C	11: 69,431,094	Y3800C	probably damaging	Het
Dsg2	G	A	18: 20,591,931	V465I	possibly damaging	Het
Dzip1	T	C	14: 118,885,646	T646A	probably benign	Het
Etv4	T	A	11: 101,784,325		probably null	Het
Exoc3l2	T	C	7: 19,484,703	V549A	unknown	Het
Ficd	G	T	5: 113,738,819	A352S	probably damaging	Het
Fry	T	G	5: 150,466,786	I179S		Het
Galntl5	A	G	5: 25,195,300	H109R	probably benign	Het
Garem1	C	A	18: 21,148,754	G182W	probably damaging	Het
Gm10696	T	C	3: 94,176,360	E48G	probably benign	Het
Gm13078	T	A	4: 143,726,279	D93E	probably benign	Het
Gm5916	A	T	9: 36,120,989	Y50N	possibly damaging	Het
Gtf2h2	A	T	13: 100,479,201	F271I	probably benign	Het
Hivep2	G	T	10: 14,129,101	S481I	probably benign	Het
Homez	T	A	14: 54,857,420	Q277L	probably damaging	Het
Hoxb4	C	A	11: 96,319,896		probably null	Het
Igll1	A	G	16: 16,861,093	S118P	probably damaging	Het
Ikzf2	A	C	1: 69,578,053		probably null	Het
Kif5b	A	G	18: 6,225,340	V230A	probably damaging	Het
Ldlr	T	A	9: 21,745,744	V719E	probably benign	Het
Lsm7	G	A	10: 80,853,731	R66W	possibly damaging	Het
Map3k13	T	A	16: 21,892,238	D90E	probably benign	Het
Mmrn1	A	G	6: 60,976,114	K460E	probably damaging	Het
Myh10	A	C	11: 68,790,689	N1061H	probably damaging	Het
Nepn	A	G	10: 52,400,993	Q275R	probably benign	Het
Noc3l	A	T	19: 38,812,356	D227E	probably benign	Het
Nploc4	G	T	11: 120,428,550	S61R	probably benign	Het
Nr4a2	T	C	2: 57,112,369	Y24C	probably damaging	Het
Nup160	T	A	2: 90,723,355	I1143N	probably damaging	Het
Olfr1097	A	G	2: 86,890,612	S188P	probably damaging	Het
Olfr1234	A	T	2: 89,362,494	Y312N	probably benign	Het
Olfr294	G	T	7: 86,615,665	H327N	probably benign	Het
Olfr895	T	A	9: 38,268,708	M57K	probably damaging	Het
Papola	T	A	12: 105,809,345	C204S	probably damaging	Het
Peg10	CCACATCAGGATCCACATCAGGATGCACATCAGCATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAG	CCACATCAGGATCCACATCAGGATGCACATCAG	6: 4,756,398		probably benign	Het
Pgap1	A	T	1: 54,493,207		probably null	Het
Pitrm1	A	G	13: 6,556,597	H229R	probably damaging	Het
Plcl1	A	G	1: 55,698,218	Q906R	probably benign	Het
Ppfia3	T	C	7: 45,341,743	N1018S	probably benign	Het
Prkd1	A	G	12: 50,388,342	V534A	possibly damaging	Het
Pygm	A	T	19: 6,385,896	I126F	probably benign	Het
Rag1	T	C	2: 101,642,070	Y909C	probably damaging	Het
Rasgrf2	G	A	13: 91,884,518	Q560*	probably null	Het
Rbp3	A	T	14: 33,962,583	I1190F	possibly damaging	Het
Reln	T	C	5: 21,978,923	K1693E	probably benign	Het
Rgl2	T	C	17: 33,934,990	F457L	possibly damaging	Het
Rsph3a	A	G	17: 7,946,170	T121A	probably benign	Het
Rufy3	A	G	5: 88,614,947	N112S	possibly damaging	Het
Ryr3	G	A	2: 112,672,246	Q3548*	probably null	Het
Sardh	A	T	2: 27,218,812	V637D	probably benign	Het
Spata16	T	C	3: 26,667,867	V179A	probably benign	Het
Tbc1d30	G	A	10: 121,288,965	T319I	probably damaging	Het
Tlr2	T	A	3: 83,837,606	Q390L	possibly damaging	Het
Tmem53	C	T	4: 117,252,040		probably null	Het
Vmn1r113	T	A	7: 20,787,445	I54N	probably damaging	Het
Vmn1r223	A	C	13: 23,249,866	Y210S	probably damaging	Het

Other mutations in Zbbx

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00561:Zbbx	APN	3	75061532	critical splice donor site	probably null
IGL01328:Zbbx	APN	3	75093075	nonsense	probably null
IGL01340:Zbbx	APN	3	75105650	missense	possibly damaging	0.53
IGL01631:Zbbx	APN	3	75078677	missense	probably damaging	0.99
IGL01681:Zbbx	APN	3	75052478	missense	probably damaging	1.00
IGL02427:Zbbx	APN	3	75139598	missense	probably benign	0.04
IGL03077:Zbbx	APN	3	75081846	missense	possibly damaging	0.61
IGL03115:Zbbx	APN	3	75078560	missense	probably benign	0.03
IGL03162:Zbbx	APN	3	75071623	splice site	probably benign
Eland	UTSW	3	75071712	missense	probably benign	0.01
PIT4480001:Zbbx	UTSW	3	75136487	missense	probably damaging	1.00
PIT4495001:Zbbx	UTSW	3	75061637	missense	probably damaging	1.00
R0179:Zbbx	UTSW	3	75085562	splice site	probably benign
R0396:Zbbx	UTSW	3	75078495	missense	possibly damaging	0.81
R0523:Zbbx	UTSW	3	75081858	missense	probably benign	0.03
R0603:Zbbx	UTSW	3	75078450	missense	probably benign	0.05
R0745:Zbbx	UTSW	3	75155427	missense	probably damaging	1.00
R0747:Zbbx	UTSW	3	75155427	missense	probably damaging	1.00
R1208:Zbbx	UTSW	3	75037992	missense	possibly damaging	0.94
R1208:Zbbx	UTSW	3	75037992	missense	possibly damaging	0.94
R1371:Zbbx	UTSW	3	75052477	missense	possibly damaging	0.58
R1769:Zbbx	UTSW	3	75083619	splice site	probably benign
R1906:Zbbx	UTSW	3	75071740	missense	probably damaging	1.00
R2069:Zbbx	UTSW	3	75078412	missense	probably benign	0.01
R2165:Zbbx	UTSW	3	75112107	missense	probably damaging	0.99
R2174:Zbbx	UTSW	3	75052414	missense	possibly damaging	0.93
R2979:Zbbx	UTSW	3	75078486	nonsense	probably null
R3121:Zbbx	UTSW	3	75081846	missense	possibly damaging	0.88
R3755:Zbbx	UTSW	3	75105671	missense	probably damaging	1.00
R3756:Zbbx	UTSW	3	75105671	missense	probably damaging	1.00
R3816:Zbbx	UTSW	3	75085495	missense	probably benign	0.00
R4002:Zbbx	UTSW	3	75105671	missense	probably damaging	1.00
R4003:Zbbx	UTSW	3	75105671	missense	probably damaging	1.00
R4057:Zbbx	UTSW	3	75105671	missense	probably damaging	1.00
R4072:Zbbx	UTSW	3	75105671	missense	probably damaging	1.00
R4073:Zbbx	UTSW	3	75105671	missense	probably damaging	1.00
R4075:Zbbx	UTSW	3	75105671	missense	probably damaging	1.00
R4114:Zbbx	UTSW	3	75139598	missense	probably benign	0.04
R4784:Zbbx	UTSW	3	75085041	missense	probably benign	0.05
R4821:Zbbx	UTSW	3	75081747	missense	possibly damaging	0.68
R5008:Zbbx	UTSW	3	75151448	missense	possibly damaging	0.62
R5030:Zbbx	UTSW	3	75083683	missense	possibly damaging	0.83
R5388:Zbbx	UTSW	3	75083670	missense	probably damaging	0.98
R6398:Zbbx	UTSW	3	75078565	missense	probably damaging	0.96
R6462:Zbbx	UTSW	3	75078659	missense	probably benign	0.07
R6597:Zbbx	UTSW	3	75136454	missense	probably damaging	1.00
R6882:Zbbx	UTSW	3	75071712	missense	probably benign	0.01
R7084:Zbbx	UTSW	3	75139546	missense	possibly damaging	0.92
R7096:Zbbx	UTSW	3	75081737	missense	probably benign	0.03
R7102:Zbbx	UTSW	3	75112094	missense	probably benign	0.06
R7537:Zbbx	UTSW	3	75085519	missense	probably damaging	1.00
R7836:Zbbx	UTSW	3	75078474	missense	possibly damaging	0.65
R7905:Zbbx	UTSW	3	75085513	missense	probably benign	0.23
R8110:Zbbx	UTSW	3	75155442	missense	possibly damaging	0.58
R8367:Zbbx	UTSW	3	75081727	critical splice donor site	probably null
R8772:Zbbx	UTSW	3	75155385	missense	probably benign	0.37
R8859:Zbbx	UTSW	3	75061434	missense	unknown
R9012:Zbbx	UTSW	3	75061653	missense	possibly damaging	0.73
R9062:Zbbx	UTSW	3	75081817	missense	possibly damaging	0.78
R9119:Zbbx	UTSW	3	75078590	missense	probably damaging	0.99
R9401:Zbbx	UTSW	3	75112083	missense	probably benign	0.26
R9531:Zbbx	UTSW	3	75078558	missense	probably damaging	1.00
R9678:Zbbx	UTSW	3	75139534	missense	probably damaging	1.00
R9736:Zbbx	UTSW	3	75061434	missense	unknown
R9780:Zbbx	UTSW	3	75038052	missense	probably damaging	1.00
Z1177:Zbbx	UTSW	3	75071783	critical splice acceptor site	probably null
Z1177:Zbbx	UTSW	3	75105684	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- TGGAAGAGTATTATTTCCTTTCCCC -3'
(R):5'- GTCCCCTTGTTTCCTGAATGAATG -3'

Sequencing Primer
(F):5'- GAATGACACACACTATTTAGCAGAG -3'
(R):5'- GTGGTAGTGATATATGGAATCACATG -3'

Posted On

2019-06-26