Incidental Mutation 'R4075:Zbbx'
ID316503
Institutional Source Beutler Lab
Gene Symbol Zbbx
Ensembl Gene ENSMUSG00000034151
Gene Namezinc finger, B-box domain containing
Synonyms
MMRRC Submission 040974-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.059) question?
Stock #R4075 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location75037907-75165034 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 75105671 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Glutamic Acid at position 151 (G151E)
Ref Sequence ENSEMBL: ENSMUSP00000103405 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039269] [ENSMUST00000107775] [ENSMUST00000107776] [ENSMUST00000107778]
Predicted Effect possibly damaging
Transcript: ENSMUST00000039269
AA Change: G151E

PolyPhen 2 Score 0.768 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000043970
Gene: ENSMUSG00000034151
AA Change: G151E

DomainStartEndE-ValueType
Blast:BBOX 13 58 5e-22 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000107775
AA Change: G151E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000103404
Gene: ENSMUSG00000034151
AA Change: G151E

DomainStartEndE-ValueType
Pfam:zf-B_box 12 58 3.9e-7 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000107776
AA Change: G151E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000103405
Gene: ENSMUSG00000034151
AA Change: G151E

DomainStartEndE-ValueType
Blast:BBOX 13 58 1e-21 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000107778
AA Change: G151E

PolyPhen 2 Score 0.768 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000103407
Gene: ENSMUSG00000034151
AA Change: G151E

DomainStartEndE-ValueType
Blast:BBOX 13 58 5e-22 BLAST
Meta Mutation Damage Score 0.1153 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
8430408G22Rik A G 6: 116,652,068 N124S possibly damaging Het
Acsm4 T A 7: 119,698,758 L206H probably benign Het
Adgrf5 T G 17: 43,450,195 V927G probably damaging Het
Agtr1a A G 13: 30,381,834 N294S probably damaging Het
Aspm T C 1: 139,474,285 L1229S probably damaging Het
Chmp7 A T 14: 69,732,281 V70E probably damaging Het
Cnot10 A G 9: 114,622,947 F254L possibly damaging Het
Cubn A G 2: 13,313,999 V2963A possibly damaging Het
Dnah5 T A 15: 28,293,791 D1347E probably benign Het
Dsg1a T G 18: 20,340,070 N733K possibly damaging Het
Dst A G 1: 34,192,269 E2656G probably benign Het
Egf C T 3: 129,735,969 R264Q probably benign Het
Eqtn A G 4: 94,919,962 I201T possibly damaging Het
Ercc4 G A 16: 13,130,685 V499I probably damaging Het
Fsip2 C T 2: 82,982,901 S3188L probably benign Het
Gm14085 T G 2: 122,514,411 V166G probably benign Het
Gm5346 A T 8: 43,626,350 F279Y probably damaging Het
Herc1 A G 9: 66,418,492 D1416G probably benign Het
Hormad1 T C 3: 95,578,203 M234T possibly damaging Het
Ifi44 A T 3: 151,745,976 N164K probably benign Het
Ikzf3 G T 11: 98,467,643 Y289* probably null Het
Il17rc A G 6: 113,481,197 D327G possibly damaging Het
Lamp3 A G 16: 19,700,716 L239P possibly damaging Het
Lce1l C T 3: 92,850,233 S106N unknown Het
Lrig3 C T 10: 126,013,408 T999I probably benign Het
Map4k4 T C 1: 40,023,462 Y1196H probably damaging Het
Mtr C A 13: 12,215,412 probably null Het
Nlrp4c A G 7: 6,072,710 K667E probably benign Het
Nxt1 A G 2: 148,675,732 D131G probably damaging Het
Obox3 G T 7: 15,625,799 T315N possibly damaging Het
Olfr1350 T C 7: 6,570,143 S51P probably benign Het
Olfr670 A T 7: 104,960,716 N5K probably damaging Het
Pcdh7 A G 5: 57,721,808 R902G probably damaging Het
Pidd1 A G 7: 141,440,826 F453L probably damaging Het
Ptpn1 T A 2: 167,976,513 probably null Het
Rev1 T G 1: 38,054,238 K1075T possibly damaging Het
Slco1a5 A T 6: 142,268,224 I57K possibly damaging Het
Ssrp1 A C 2: 85,045,568 K590N possibly damaging Het
Svs2 T C 2: 164,237,318 E223G probably benign Het
Tab3 G T X: 85,614,457 V197F probably damaging Het
Tm2d3 T A 7: 65,697,750 L49* probably null Het
Usp31 A G 7: 121,667,782 probably null Het
Vmn2r24 A T 6: 123,787,415 H417L possibly damaging Het
Zbtb11 C T 16: 55,998,064 T617I possibly damaging Het
Zfp677 T C 17: 21,398,159 Y493H probably damaging Het
Other mutations in Zbbx
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00561:Zbbx APN 3 75061532 critical splice donor site probably null
IGL01328:Zbbx APN 3 75093075 nonsense probably null
IGL01340:Zbbx APN 3 75105650 missense possibly damaging 0.53
IGL01631:Zbbx APN 3 75078677 missense probably damaging 0.99
IGL01681:Zbbx APN 3 75052478 missense probably damaging 1.00
IGL02427:Zbbx APN 3 75139598 missense probably benign 0.04
IGL03077:Zbbx APN 3 75081846 missense possibly damaging 0.61
IGL03115:Zbbx APN 3 75078560 missense probably benign 0.03
IGL03162:Zbbx APN 3 75071623 splice site probably benign
Eland UTSW 3 75071712 missense probably benign 0.01
PIT4480001:Zbbx UTSW 3 75136487 missense probably damaging 1.00
PIT4495001:Zbbx UTSW 3 75061637 missense probably damaging 1.00
R0179:Zbbx UTSW 3 75085562 splice site probably benign
R0396:Zbbx UTSW 3 75078495 missense possibly damaging 0.81
R0523:Zbbx UTSW 3 75081858 missense probably benign 0.03
R0603:Zbbx UTSW 3 75078450 missense probably benign 0.05
R0745:Zbbx UTSW 3 75155427 missense probably damaging 1.00
R0747:Zbbx UTSW 3 75155427 missense probably damaging 1.00
R1208:Zbbx UTSW 3 75037992 missense possibly damaging 0.94
R1208:Zbbx UTSW 3 75037992 missense possibly damaging 0.94
R1371:Zbbx UTSW 3 75052477 missense possibly damaging 0.58
R1769:Zbbx UTSW 3 75083619 splice site probably benign
R1906:Zbbx UTSW 3 75071740 missense probably damaging 1.00
R2069:Zbbx UTSW 3 75078412 missense probably benign 0.01
R2165:Zbbx UTSW 3 75112107 missense probably damaging 0.99
R2174:Zbbx UTSW 3 75052414 missense possibly damaging 0.93
R2979:Zbbx UTSW 3 75078486 nonsense probably null
R3121:Zbbx UTSW 3 75081846 missense possibly damaging 0.88
R3755:Zbbx UTSW 3 75105671 missense probably damaging 1.00
R3756:Zbbx UTSW 3 75105671 missense probably damaging 1.00
R3816:Zbbx UTSW 3 75085495 missense probably benign 0.00
R4002:Zbbx UTSW 3 75105671 missense probably damaging 1.00
R4003:Zbbx UTSW 3 75105671 missense probably damaging 1.00
R4057:Zbbx UTSW 3 75105671 missense probably damaging 1.00
R4072:Zbbx UTSW 3 75105671 missense probably damaging 1.00
R4073:Zbbx UTSW 3 75105671 missense probably damaging 1.00
R4114:Zbbx UTSW 3 75139598 missense probably benign 0.04
R4784:Zbbx UTSW 3 75085041 missense probably benign 0.05
R4821:Zbbx UTSW 3 75081747 missense possibly damaging 0.68
R5008:Zbbx UTSW 3 75151448 missense possibly damaging 0.62
R5030:Zbbx UTSW 3 75083683 missense possibly damaging 0.83
R5388:Zbbx UTSW 3 75083670 missense probably damaging 0.98
R6398:Zbbx UTSW 3 75078565 missense probably damaging 0.96
R6462:Zbbx UTSW 3 75078659 missense probably benign 0.07
R6597:Zbbx UTSW 3 75136454 missense probably damaging 1.00
R6882:Zbbx UTSW 3 75071712 missense probably benign 0.01
R7084:Zbbx UTSW 3 75139546 missense possibly damaging 0.92
R7096:Zbbx UTSW 3 75081737 missense probably benign 0.03
R7102:Zbbx UTSW 3 75112094 missense probably benign 0.06
R7256:Zbbx UTSW 3 75039898 missense probably benign 0.02
R7537:Zbbx UTSW 3 75085519 missense probably damaging 1.00
R7836:Zbbx UTSW 3 75078474 missense possibly damaging 0.65
R7905:Zbbx UTSW 3 75085513 missense probably benign 0.23
R8110:Zbbx UTSW 3 75155442 missense possibly damaging 0.58
R8367:Zbbx UTSW 3 75081727 critical splice donor site probably null
Z1177:Zbbx UTSW 3 75071783 critical splice acceptor site probably null
Z1177:Zbbx UTSW 3 75105684 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CTTGGGAAGCTCTAGCAAATTG -3'
(R):5'- ATCTGAGCCAACCATTTATAACTGC -3'

Sequencing Primer
(F):5'- GCTCTTTATTGGTTTTAAGCATCAC -3'
(R):5'- TCATGTCCTGATAAGATGCAGG -3'
Posted On2015-05-15