Incidental Mutation 'R6443:Txndc5'
ID519104
Institutional Source Beutler Lab
Gene Symbol Txndc5
Ensembl Gene ENSMUSG00000038991
Gene Namethioredoxin domain containing 5
SynonymsPC-TRP, ERp46
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6443 (G1)
Quality Score108.008
Status Validated
Chromosome13
Chromosomal Location38500079-38528824 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 38528203 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Threonine at position 69 (M69T)
Ref Sequence ENSEMBL: ENSMUSP00000041839 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035988] [ENSMUST00000160653] [ENSMUST00000162075]
Predicted Effect possibly damaging
Transcript: ENSMUST00000035988
AA Change: M69T

PolyPhen 2 Score 0.555 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000041839
Gene: ENSMUSG00000038991
AA Change: M69T

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
Pfam:Thioredoxin 49 153 5.3e-28 PFAM
low complexity region 156 172 N/A INTRINSIC
Pfam:Thioredoxin 176 279 2.8e-30 PFAM
Pfam:Thioredoxin 308 412 6.2e-32 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000160653
SMART Domains Protein: ENSMUSP00000124401
Gene: ENSMUSG00000038991

DomainStartEndE-ValueType
Pfam:Thioredoxin 1 80 6.3e-22 PFAM
low complexity region 83 99 N/A INTRINSIC
Pfam:Thioredoxin 103 206 4.2e-31 PFAM
Pfam:Thioredoxin 235 339 3.9e-32 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000162075
SMART Domains Protein: ENSMUSP00000124516
Gene: ENSMUSG00000038991

DomainStartEndE-ValueType
Pfam:Thioredoxin 1 59 1.5e-13 PFAM
low complexity region 62 78 N/A INTRINSIC
Pfam:Thioredoxin 82 185 5e-31 PFAM
Pfam:Thioredoxin 214 318 4.6e-32 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224471
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.5%
  • 20x: 91.9%
Validation Efficiency 97% (37/38)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the disulfide isomerase (PDI) family of endoplasmic reticulum (ER) proteins that catalyze protein folding and thiol-disulfide interchange reactions. The encoded protein has an N-terminal endoplasmic reticulum (ER)-signal sequence, three catalytically active thioredoxin domains and a C-terminal ER-retention sequence. Its expression is induced by hypoxia and its role may be to protect hypoxic cells from apoptosis. Alternative splicing results in multiple transcript variants. Read-through transcription also exists between this gene and the neighboring upstream BLOC1S5 gene. [provided by RefSeq, Dec 2016]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aasdhppt A G 9: 4,309,357 L27P probably damaging Het
Actr6 T C 10: 89,714,871 N354D probably damaging Het
Apbb1 T A 7: 105,573,763 N214Y probably damaging Het
Bcar1 A T 8: 111,715,338 V290E probably damaging Het
Ces1f T A 8: 93,275,365 Q45L probably benign Het
Ctss A C 3: 95,546,803 K221T probably benign Het
Dclre1b T A 3: 103,803,188 N469I possibly damaging Het
Dnah12 C A 14: 26,878,051 Q3683K probably benign Het
Dnah8 A G 17: 30,771,885 I3301V probably benign Het
Ephb4 G A 5: 137,360,449 G298E probably damaging Het
Eya3 T C 4: 132,711,927 F455L probably damaging Het
Fkbp5 G T 17: 28,429,279 A112D probably damaging Het
Glud1 T C 14: 34,339,927 M468T probably benign Het
Gm5114 C A 7: 39,407,717 R826L possibly damaging Het
Gramd3 G A 18: 56,485,385 V222I probably benign Het
Kif1b T C 4: 149,192,596 M1337V probably benign Het
Lpin2 T C 17: 71,241,668 S576P probably benign Het
Lrrc1 A G 9: 77,434,032 F415L probably damaging Het
Mtmr3 A T 11: 4,487,358 I1032K probably damaging Het
Nr5a1 G A 2: 38,710,430 T75M probably damaging Het
Nwd1 G A 8: 72,662,366 V141I possibly damaging Het
Olfr1019 T G 2: 85,841,635 D52A probably damaging Het
Olfr22-ps1 A T 11: 73,955,092 Q134L probably benign Het
Olfr807 C A 10: 129,755,408 G14V probably damaging Het
Pla1a T C 16: 38,409,587 probably null Het
Ppp1r36 A G 12: 76,417,639 S4G probably benign Het
Rsf1 G GACGGCGGCT 7: 97,579,909 probably benign Homo
Ryr1 A T 7: 29,077,078 M2204K probably damaging Het
Ryr3 T C 2: 112,675,933 N3428S possibly damaging Het
Slc6a4 A G 11: 77,023,201 K526E probably benign Het
Slc9a8 G A 2: 167,434,821 R78H probably benign Het
Sptbn1 T C 11: 30,139,429 D611G possibly damaging Het
Sstr2 G A 11: 113,625,254 probably null Het
Tcf7 G T 11: 52,253,938 T286N probably benign Het
Usp48 T A 4: 137,613,763 V358E probably damaging Het
Vmn2r1 T A 3: 64,104,953 I745K possibly damaging Het
Zfp354b A G 11: 50,922,754 I448T possibly damaging Het
Zfp523 A T 17: 28,201,407 T189S probably damaging Het
Other mutations in Txndc5
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0164:Txndc5 UTSW 13 38507953 missense probably damaging 1.00
R0164:Txndc5 UTSW 13 38507953 missense probably damaging 1.00
R0691:Txndc5 UTSW 13 38507896 missense probably damaging 1.00
R0741:Txndc5 UTSW 13 38528260 missense possibly damaging 0.94
R3810:Txndc5 UTSW 13 38523405 missense probably benign 0.30
R3811:Txndc5 UTSW 13 38523405 missense probably benign 0.30
R3812:Txndc5 UTSW 13 38523405 missense probably benign 0.30
R5009:Txndc5 UTSW 13 38528184 splice site probably null
R5472:Txndc5 UTSW 13 38513125 missense possibly damaging 0.65
R6089:Txndc5 UTSW 13 38523416 start codon destroyed probably null 0.70
R6292:Txndc5 UTSW 13 38528184 splice site probably null
R8442:Txndc5 UTSW 13 38527869 intron probably benign
X0067:Txndc5 UTSW 13 38523387 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACCCTTCAGGATAGGGCAC -3'
(R):5'- CTTTCAGCAGAAGACAGCAAGTTG -3'

Sequencing Primer
(F):5'- CTTCAGGATAGGGCACGTGGAC -3'
(R):5'- ATTGAGGCGTGGCTCTGC -3'
Posted On2018-05-24