Incidental Mutation 'R6552:Creb5'
ID521682
Institutional Source Beutler Lab
Gene Symbol Creb5
Ensembl Gene ENSMUSG00000053007
Gene NamecAMP responsive element binding protein 5
SynonymsCrebpa, D430026C09Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6552 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location53287270-53700376 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 53685384 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 222 (D222G)
Ref Sequence ENSEMBL: ENSMUSP00000144719 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047450] [ENSMUST00000203487] [ENSMUST00000203528] [ENSMUST00000205120]
Predicted Effect possibly damaging
Transcript: ENSMUST00000047450
AA Change: D366G

PolyPhen 2 Score 0.922 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000038532
Gene: ENSMUSG00000053007
AA Change: D366G

DomainStartEndE-ValueType
low complexity region 117 178 N/A INTRINSIC
low complexity region 196 211 N/A INTRINSIC
BRLZ 222 286 1.91e-20 SMART
low complexity region 304 318 N/A INTRINSIC
low complexity region 329 344 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000203487
AA Change: D373G

PolyPhen 2 Score 0.922 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000144851
Gene: ENSMUSG00000053007
AA Change: D373G

DomainStartEndE-ValueType
ZnF_C2H2 16 40 7.9e-5 SMART
low complexity region 268 329 N/A INTRINSIC
low complexity region 347 362 N/A INTRINSIC
BRLZ 373 437 8e-23 SMART
low complexity region 455 469 N/A INTRINSIC
low complexity region 480 495 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000203528
AA Change: D366G

PolyPhen 2 Score 0.922 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000144979
Gene: ENSMUSG00000053007
AA Change: D366G

DomainStartEndE-ValueType
ZnF_C2H2 9 33 7.9e-5 SMART
low complexity region 261 322 N/A INTRINSIC
low complexity region 340 355 N/A INTRINSIC
BRLZ 366 430 8e-23 SMART
low complexity region 448 462 N/A INTRINSIC
low complexity region 473 488 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000205120
AA Change: D222G

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000144719
Gene: ENSMUSG00000053007
AA Change: D222G

DomainStartEndE-ValueType
low complexity region 117 178 N/A INTRINSIC
low complexity region 196 211 N/A INTRINSIC
BRLZ 222 286 1.91e-20 SMART
low complexity region 304 318 N/A INTRINSIC
low complexity region 329 344 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene belongs to the CRE (cAMP response element)-binding protein family. Members of this family contain zinc-finger and bZIP DNA-binding domains. The encoded protein specifically binds to CRE as a homodimer or a heterodimer with c-Jun or CRE-BP1, and functions as a CRE-dependent trans-activator. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null mutation display neonatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ang5 A T 14: 43,962,797 H106L probably benign Het
Arsk A G 13: 76,072,196 Y260H probably damaging Het
Atxn2l C T 7: 126,493,821 V833M possibly damaging Het
Bpifa6 G A 2: 153,987,158 D202N probably damaging Het
Ccdc103 A G 11: 102,884,144 S190G probably benign Het
Col6a6 C T 9: 105,698,913 V2083I probably damaging Het
Cyp7a1 C T 4: 6,272,361 W284* probably null Het
Dnmt3a T C 12: 3,907,623 V868A probably damaging Het
Efr3a A G 15: 65,857,490 D680G possibly damaging Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Epb41l4a A G 18: 33,878,979 Y163H probably damaging Het
Gabra1 A T 11: 42,147,099 S231T probably damaging Het
Golga4 T A 9: 118,514,231 F42I probably damaging Het
Greb1l G A 18: 10,541,814 S1187N probably benign Het
Haspin A G 11: 73,137,564 V233A probably benign Het
Il34 T A 8: 110,742,427 K187I probably benign Het
Kcnn2 A G 18: 45,560,098 H247R probably benign Het
Klf5 T C 14: 99,301,642 S84P probably benign Het
Lama5 G T 2: 180,181,154 P2773Q probably damaging Het
Lcat T C 8: 105,939,679 M404V possibly damaging Het
Lrp6 A T 6: 134,454,729 S1473T probably benign Het
Lsm3 GATATATA GATATATATA 6: 91,519,635 probably null Het
Mn1 T C 5: 111,420,887 S908P possibly damaging Het
Olfr107 G A 17: 37,405,905 R119H probably benign Het
Olfr695 TGAAGCC T 7: 106,714,643 probably benign Het
Pcdhb2 A T 18: 37,295,993 M340L probably benign Het
Pex1 G A 5: 3,623,953 E748K probably damaging Het
Qrich1 T C 9: 108,534,305 V343A possibly damaging Het
Rho A G 6: 115,931,748 probably null Het
Sdhaf4 C A 1: 24,005,606 probably benign Het
Sec24d A G 3: 123,290,552 I127V probably benign Het
Siae T C 9: 37,646,400 V501A possibly damaging Het
Skint3 T C 4: 112,290,285 Y402H possibly damaging Het
Skint6 A C 4: 113,067,490 V515G possibly damaging Het
Slc23a1 C A 18: 35,622,338 G475C probably damaging Het
Smad9 A G 3: 54,782,746 Y129C probably damaging Het
Snw1 A G 12: 87,459,419 probably null Het
Spice1 A G 16: 44,379,033 D616G possibly damaging Het
Stam2 T C 2: 52,708,227 probably null Het
Sumo3 G T 10: 77,606,257 probably benign Het
Syne2 T G 12: 75,890,241 N204K possibly damaging Het
Tmem200a T C 10: 25,993,483 N296S probably damaging Het
Ttbk1 G T 17: 46,478,962 T125N probably benign Het
Ubr2 G T 17: 46,966,268 probably null Het
Vmn1r80 C T 7: 12,193,757 L265F probably damaging Het
Vwa8 A T 14: 79,198,222 T1791S possibly damaging Het
Other mutations in Creb5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02114:Creb5 APN 6 53604458 splice site probably benign
IGL02475:Creb5 APN 6 53693924 missense probably damaging 0.98
IGL02663:Creb5 APN 6 53680961 missense probably damaging 0.99
R0054:Creb5 UTSW 6 53447657 missense probably benign 0.27
R0452:Creb5 UTSW 6 53604542 missense possibly damaging 0.94
R4580:Creb5 UTSW 6 53604534 missense possibly damaging 0.46
R4809:Creb5 UTSW 6 53610426 missense probably null 0.71
R4957:Creb5 UTSW 6 53693922 critical splice acceptor site probably null
R5375:Creb5 UTSW 6 53681017 missense possibly damaging 0.79
R6616:Creb5 UTSW 6 53685310 missense possibly damaging 0.96
R6679:Creb5 UTSW 6 53685469 missense possibly damaging 0.51
R6745:Creb5 UTSW 6 53604532 missense probably benign 0.03
R7428:Creb5 UTSW 6 53681158 missense unknown
R7581:Creb5 UTSW 6 53681237 missense probably damaging 0.99
X0065:Creb5 UTSW 6 53685401 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- TCCCCTGAGAACAAGTTTCCC -3'
(R):5'- GAAACGCCAGCTGTGATGAG -3'

Sequencing Primer
(F):5'- CCCTTGCTTACTAAAATGTAACTGGC -3'
(R):5'- AGCTGTGATGAGGCCGG -3'
Posted On2018-06-06