Incidental Mutation 'R6493:Myl2'
ID522838
Institutional Source Beutler Lab
Gene Symbol Myl2
Ensembl Gene ENSMUSG00000013936
Gene Namemyosin, light polypeptide 2, regulatory, cardiac, slow
SynonymsMlc2v, MLC-2v, MLC-2, Mylpc
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6493 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location122100951-122113472 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 122106728 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Aspartic acid at position 154 (N154D)
Ref Sequence ENSEMBL: ENSMUSP00000107380 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000014080] [ENSMUST00000058960] [ENSMUST00000111750] [ENSMUST00000111751] [ENSMUST00000139213] [ENSMUST00000146733] [ENSMUST00000150535] [ENSMUST00000152389] [ENSMUST00000155612]
Predicted Effect possibly damaging
Transcript: ENSMUST00000014080
AA Change: N154D

PolyPhen 2 Score 0.636 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000014080
Gene: ENSMUSG00000013936
AA Change: N154D

DomainStartEndE-ValueType
EFh 28 56 2.81e-5 SMART
EFh 98 126 4.53e0 SMART
EFh 134 162 3.97e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000058960
SMART Domains Protein: ENSMUSP00000050582
Gene: ENSMUSG00000043036

DomainStartEndE-ValueType
coiled coil region 140 158 N/A INTRINSIC
coiled coil region 209 285 N/A INTRINSIC
low complexity region 308 318 N/A INTRINSIC
coiled coil region 393 438 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111750
SMART Domains Protein: ENSMUSP00000107379
Gene: ENSMUSG00000013936

DomainStartEndE-ValueType
EFh 28 56 2.81e-5 SMART
EFh 98 126 4.53e0 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000111751
AA Change: N154D

PolyPhen 2 Score 0.636 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000107380
Gene: ENSMUSG00000013936
AA Change: N154D

DomainStartEndE-ValueType
EFh 28 56 2.81e-5 SMART
EFh 98 126 4.53e0 SMART
EFh 134 162 3.97e1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123913
Predicted Effect probably benign
Transcript: ENSMUST00000126006
SMART Domains Protein: ENSMUSP00000123261
Gene: ENSMUSG00000013936

DomainStartEndE-ValueType
PDB:2W4H|B 2 62 4e-8 PDB
SCOP:d1wdcb_ 10 62 4e-5 SMART
Blast:EFh 37 62 3e-11 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000139213
SMART Domains Protein: ENSMUSP00000114156
Gene: ENSMUSG00000013936

DomainStartEndE-ValueType
Pfam:EF-hand_7 6 54 7e-8 PFAM
Pfam:EF-hand_1 9 37 6.4e-8 PFAM
Pfam:EF-hand_6 9 40 6.2e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000146733
SMART Domains Protein: ENSMUSP00000142592
Gene: ENSMUSG00000013936

DomainStartEndE-ValueType
Pfam:EF-hand_7 6 54 1.2e-6 PFAM
Pfam:EF-hand_1 9 37 1.1e-6 PFAM
Pfam:EF-hand_6 9 40 1.1e-6 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147178
Predicted Effect probably benign
Transcript: ENSMUST00000150535
SMART Domains Protein: ENSMUSP00000120274
Gene: ENSMUSG00000013936

DomainStartEndE-ValueType
Pfam:EF-hand_7 6 54 6.2e-8 PFAM
Pfam:EF-hand_1 9 37 5.8e-8 PFAM
Pfam:EF-hand_6 9 40 5.6e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000152389
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152744
Predicted Effect probably benign
Transcript: ENSMUST00000153816
SMART Domains Protein: ENSMUSP00000119627
Gene: ENSMUSG00000013936

DomainStartEndE-ValueType
Pfam:EF-hand_1 62 90 2.4e-8 PFAM
Pfam:EF-hand_6 62 91 7.5e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000155612
SMART Domains Protein: ENSMUSP00000120105
Gene: ENSMUSG00000013936

DomainStartEndE-ValueType
EFh 9 37 2.81e-5 SMART
EFh 79 107 4.53e0 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198618
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.4%
  • 10x: 97.3%
  • 20x: 91.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Thus gene encodes the regulatory light chain associated with cardiac myosin beta (or slow) heavy chain. Ca+ triggers the phosphorylation of regulatory light chain that in turn triggers contraction. Mutations in this gene are associated with mid-left ventricular chamber type hypertrophic cardiomyopathy. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice heterozygous for a knock-in allele exhibit embryonic growth retardation and die between E12.5 and E14.5 with abnormal heart development characterized by a single ventricle, complete absence of the interventricular groove and septum, and a thin myocardium compact layer. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca5 T A 11: 110,293,878 H934L probably benign Het
Abcb1b G A 5: 8,824,698 D453N probably damaging Het
Ampd3 A G 7: 110,795,811 probably null Het
Axdnd1 A T 1: 156,380,813 I485N probably damaging Het
Bscl2 A G 19: 8,839,774 D22G probably damaging Het
Ccdc96 A G 5: 36,486,252 E534G probably damaging Het
Cdc42bpg G T 19: 6,318,455 G1061V probably damaging Het
Cers3 T C 7: 66,743,720 Y26H probably benign Het
Chd1l G A 3: 97,587,167 A399V probably damaging Het
Clca4a T A 3: 144,957,298 T597S probably benign Het
Daxx T A 17: 33,912,371 probably null Het
Egf T C 3: 129,719,088 probably benign Het
Eps15 A G 4: 109,368,948 D629G probably damaging Het
Fancm G A 12: 65,097,488 A575T probably benign Het
Fat4 G A 3: 38,890,887 D1310N probably damaging Het
Gm10424 A G 5: 95,270,825 L104P probably damaging Het
Gm11595 G A 11: 99,772,555 R100C unknown Het
Grxcr2 G A 18: 41,998,701 P101L possibly damaging Het
Hsd17b12 A T 2: 94,043,883 I225N probably damaging Het
Kcnj8 T C 6: 142,566,047 Y278C probably damaging Het
Lama3 G A 18: 12,482,148 probably null Het
Lax1 C T 1: 133,679,792 D404N probably benign Het
Lipg T C 18: 74,948,024 K329E probably damaging Het
Lysmd2 T G 9: 75,635,702 L197R probably damaging Het
Maneal A T 4: 124,857,171 I264N probably damaging Het
Myh4 A G 11: 67,258,629 N1729S probably benign Het
Nlrp9c T A 7: 26,382,387 D638V probably damaging Het
Notch1 T C 2: 26,472,098 H74R unknown Het
Olfml3 A T 3: 103,736,207 V286D possibly damaging Het
Olfr1271 G A 2: 90,265,708 H241Y probably damaging Het
Olfr228 T C 2: 86,483,221 I174V possibly damaging Het
Olfr310 T G 7: 86,268,882 K302N probably benign Het
Olfr559 G T 7: 102,724,080 R137S possibly damaging Het
Olfr562-ps1 A G 7: 102,782,396 K307E probably benign Het
Parn A C 16: 13,656,925 F127V probably damaging Het
Pcdhac2 T C 18: 37,144,705 V246A probably damaging Het
Plin2 G A 4: 86,661,987 T90I possibly damaging Het
Podxl C T 6: 31,525,046 C326Y probably damaging Het
Prl8a8 T A 13: 27,507,352 K223* probably null Het
Ptprh T G 7: 4,580,990 E201A possibly damaging Het
Rtn1 A C 12: 72,308,329 V281G probably damaging Het
Scaf8 T C 17: 3,171,119 S294P unknown Het
Shroom3 C A 5: 92,941,561 N723K probably benign Het
Spata22 T C 11: 73,353,746 *312R probably null Het
Stx7 T C 10: 24,185,071 probably null Het
Taar6 T C 10: 23,985,123 D175G probably benign Het
Tbccd1 A C 16: 22,822,466 L387R probably damaging Het
Tecpr1 T C 5: 144,209,974 M525V probably benign Het
Tex10 A T 4: 48,436,450 I756N probably damaging Het
Tfap2d G C 1: 19,104,478 G52R probably benign Het
Ttn T C 2: 76,741,997 E24438G probably damaging Het
Wdpcp C T 11: 21,711,631 T301I possibly damaging Het
Zbtb1 C T 12: 76,386,473 T411I probably benign Het
Zcchc11 A G 4: 108,526,805 K1053R probably damaging Het
Zzef1 G A 11: 72,913,303 G2624R probably benign Het
Other mutations in Myl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01068:Myl2 APN 5 122106704 missense probably benign
R2879:Myl2 UTSW 5 122104685 critical splice donor site probably null
R4580:Myl2 UTSW 5 122106738 missense probably benign 0.37
R5569:Myl2 UTSW 5 122106720 missense possibly damaging 0.95
R5782:Myl2 UTSW 5 122104870 missense probably damaging 1.00
R6560:Myl2 UTSW 5 122102771 missense probably null 1.00
R6878:Myl2 UTSW 5 122105077 missense probably benign
R7163:Myl2 UTSW 5 122101822 missense probably damaging 1.00
R7374:Myl2 UTSW 5 122101663 missense
Predicted Primers PCR Primer
(F):5'- AACTTTTGGGCCTGCTGAC -3'
(R):5'- TCACAGAACCCAAATACTTTGTGAC -3'

Sequencing Primer
(F):5'- CACCTCAAGTCCTGCTGAC -3'
(R):5'- CTTTGGCTACTTAGAGCCAAATGAGC -3'
Posted On2018-06-06