Incidental Mutation 'R6493:Kcnj8'
ID522844
Institutional Source Beutler Lab
Gene Symbol Kcnj8
Ensembl Gene ENSMUSG00000030247
Gene Namepotassium inwardly-rectifying channel, subfamily J, member 8
SynonymsKir6.1, sltr, gnite, slmbr
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6493 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location142564837-142571614 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 142566047 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 278 (Y278C)
Ref Sequence ENSEMBL: ENSMUSP00000145440 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032374] [ENSMUST00000203945]
Predicted Effect probably benign
Transcript: ENSMUST00000032374
SMART Domains Protein: ENSMUSP00000032374
Gene: ENSMUSG00000030247

DomainStartEndE-ValueType
Pfam:IRK 37 371 2.3e-141 PFAM
low complexity region 378 404 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000203945
AA Change: Y278C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000145440
Gene: ENSMUSG00000030247
AA Change: Y278C

DomainStartEndE-ValueType
Pfam:IRK 37 371 2.3e-141 PFAM
low complexity region 378 404 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.4%
  • 10x: 97.3%
  • 20x: 91.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Potassium channels are present in most mammalian cells, where they participate in a wide range of physiologic responses. The protein encoded by this gene is an integral membrane protein and inward-rectifier type potassium channel. The encoded protein, which has a greater tendency to allow potassium to flow into a cell rather than out of a cell, is controlled by G-proteins. Defects in this gene may be a cause of J-wave syndromes and sudden infant death syndrome (SIDS). [provided by RefSeq, May 2012]
PHENOTYPE: Mice homozygous for a targeted null mutation exhibit sudden cardiac death due to dysregulation of the vascular tonus in the coronary arteries, and exhibit a phenotype resembling Prinzmetal (or variant) angina in humans. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca5 T A 11: 110,293,878 H934L probably benign Het
Abcb1b G A 5: 8,824,698 D453N probably damaging Het
Ampd3 A G 7: 110,795,811 probably null Het
Axdnd1 A T 1: 156,380,813 I485N probably damaging Het
Bscl2 A G 19: 8,839,774 D22G probably damaging Het
Ccdc96 A G 5: 36,486,252 E534G probably damaging Het
Cdc42bpg G T 19: 6,318,455 G1061V probably damaging Het
Cers3 T C 7: 66,743,720 Y26H probably benign Het
Chd1l G A 3: 97,587,167 A399V probably damaging Het
Clca4a T A 3: 144,957,298 T597S probably benign Het
Daxx T A 17: 33,912,371 probably null Het
Egf T C 3: 129,719,088 probably benign Het
Eps15 A G 4: 109,368,948 D629G probably damaging Het
Fancm G A 12: 65,097,488 A575T probably benign Het
Fat4 G A 3: 38,890,887 D1310N probably damaging Het
Gm10424 A G 5: 95,270,825 L104P probably damaging Het
Gm11595 G A 11: 99,772,555 R100C unknown Het
Grxcr2 G A 18: 41,998,701 P101L possibly damaging Het
Hsd17b12 A T 2: 94,043,883 I225N probably damaging Het
Lama3 G A 18: 12,482,148 probably null Het
Lax1 C T 1: 133,679,792 D404N probably benign Het
Lipg T C 18: 74,948,024 K329E probably damaging Het
Lysmd2 T G 9: 75,635,702 L197R probably damaging Het
Maneal A T 4: 124,857,171 I264N probably damaging Het
Myh4 A G 11: 67,258,629 N1729S probably benign Het
Myl2 A G 5: 122,106,728 N154D possibly damaging Het
Nlrp9c T A 7: 26,382,387 D638V probably damaging Het
Notch1 T C 2: 26,472,098 H74R unknown Het
Olfml3 A T 3: 103,736,207 V286D possibly damaging Het
Olfr1271 G A 2: 90,265,708 H241Y probably damaging Het
Olfr228 T C 2: 86,483,221 I174V possibly damaging Het
Olfr310 T G 7: 86,268,882 K302N probably benign Het
Olfr559 G T 7: 102,724,080 R137S possibly damaging Het
Olfr562-ps1 A G 7: 102,782,396 K307E probably benign Het
Parn A C 16: 13,656,925 F127V probably damaging Het
Pcdhac2 T C 18: 37,144,705 V246A probably damaging Het
Plin2 G A 4: 86,661,987 T90I possibly damaging Het
Podxl C T 6: 31,525,046 C326Y probably damaging Het
Prl8a8 T A 13: 27,507,352 K223* probably null Het
Ptprh T G 7: 4,580,990 E201A possibly damaging Het
Rtn1 A C 12: 72,308,329 V281G probably damaging Het
Scaf8 T C 17: 3,171,119 S294P unknown Het
Shroom3 C A 5: 92,941,561 N723K probably benign Het
Spata22 T C 11: 73,353,746 *312R probably null Het
Stx7 T C 10: 24,185,071 probably null Het
Taar6 T C 10: 23,985,123 D175G probably benign Het
Tbccd1 A C 16: 22,822,466 L387R probably damaging Het
Tecpr1 T C 5: 144,209,974 M525V probably benign Het
Tex10 A T 4: 48,436,450 I756N probably damaging Het
Tfap2d G C 1: 19,104,478 G52R probably benign Het
Ttn T C 2: 76,741,997 E24438G probably damaging Het
Wdpcp C T 11: 21,711,631 T301I possibly damaging Het
Zbtb1 C T 12: 76,386,473 T411I probably benign Het
Zcchc11 A G 4: 108,526,805 K1053R probably damaging Het
Zzef1 G A 11: 72,913,303 G2624R probably benign Het
Other mutations in Kcnj8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00337:Kcnj8 APN 6 142570235 missense probably damaging 1.00
IGL02303:Kcnj8 APN 6 142570111 missense probably benign 0.01
IGL03026:Kcnj8 APN 6 142566473 critical splice acceptor site probably null
goodnight UTSW 6 large deletion
mayday UTSW 6 large deletion
slumber UTSW 6 large deletion
solitaire UTSW 6 large deletion
sos UTSW 6 142565927 missense probably damaging 1.00
R0278:Kcnj8 UTSW 6 142570348 missense probably benign 0.12
R0927:Kcnj8 UTSW 6 142565901 missense possibly damaging 0.82
R1680:Kcnj8 UTSW 6 142570189 nonsense probably null
R1864:Kcnj8 UTSW 6 142570240 missense probably damaging 1.00
R1865:Kcnj8 UTSW 6 142570240 missense probably damaging 1.00
R2087:Kcnj8 UTSW 6 142565696 missense probably benign 0.02
R4900:Kcnj8 UTSW 6 142566495 missense probably damaging 1.00
R5863:Kcnj8 UTSW 6 142565688 missense probably benign 0.02
R6598:Kcnj8 UTSW 6 142570233 missense probably damaging 1.00
R7068:Kcnj8 UTSW 6 142566239 missense probably damaging 1.00
R7587:Kcnj8 UTSW 6 142566339 missense probably damaging 1.00
R7698:Kcnj8 UTSW 6 142565753 missense probably damaging 1.00
X0018:Kcnj8 UTSW 6 142565914 missense probably benign 0.17
X0020:Kcnj8 UTSW 6 142565914 missense probably benign 0.17
X0026:Kcnj8 UTSW 6 142565914 missense probably benign 0.17
X0027:Kcnj8 UTSW 6 142565914 missense probably benign 0.17
X0061:Kcnj8 UTSW 6 142570120 missense probably damaging 1.00
X0065:Kcnj8 UTSW 6 142565914 missense probably benign 0.17
Predicted Primers PCR Primer
(F):5'- AGCCACTCTCACCGTGTTAC -3'
(R):5'- GAAGAGCATGATCATTAGCGCCTC -3'

Sequencing Primer
(F):5'- GGAATAGTCCACAGAGTACACGC -3'
(R):5'- TCGGTGCGCATCCAGGTG -3'
Posted On2018-06-06