Incidental Mutation 'R6653:Nlrp9c'
ID526506
Institutional Source Beutler Lab
Gene Symbol Nlrp9c
Ensembl Gene ENSMUSG00000040614
Gene NameNLR family, pyrin domain containing 9C
SynonymsNalp9c, Nalp-zeta
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6653 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location26322473-26403700 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 26371322 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Tyrosine at position 945 (N945Y)
Ref Sequence ENSEMBL: ENSMUSP00000083106 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041845] [ENSMUST00000085944]
Predicted Effect possibly damaging
Transcript: ENSMUST00000041845
AA Change: N833Y

PolyPhen 2 Score 0.837 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000036041
Gene: ENSMUSG00000040614
AA Change: N833Y

DomainStartEndE-ValueType
PYRIN 5 87 7.64e-22 SMART
Pfam:NACHT 143 310 5.2e-31 PFAM
LRR 637 664 4.36e1 SMART
Blast:LRR 666 691 3e-6 BLAST
LRR 693 720 1.02e0 SMART
LRR 722 749 3e0 SMART
LRR 750 777 6.88e-4 SMART
LRR 779 806 5.06e0 SMART
LRR 807 834 1.22e1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000085944
AA Change: N945Y

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000083106
Gene: ENSMUSG00000040614
AA Change: N945Y

DomainStartEndE-ValueType
PYRIN 5 87 7.64e-22 SMART
Pfam:NACHT 143 310 2.8e-31 PFAM
LRR 631 658 7.49e0 SMART
LRR 692 719 4.36e1 SMART
Blast:LRR 721 746 8e-6 BLAST
LRR 748 775 1.02e0 SMART
LRR 777 804 3e0 SMART
LRR 805 832 6.88e-4 SMART
LRR 834 861 2.17e0 SMART
LRR 862 889 2.12e-4 SMART
LRR 919 946 1.22e1 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca15 T G 7: 120,346,006 L435R probably benign Het
Abcc2 T A 19: 43,812,502 H627Q probably benign Het
Ankhd1 A T 18: 36,600,783 probably null Het
Ankrd50 T A 3: 38,457,361 I286F probably damaging Het
Asb15 A G 6: 24,562,633 N198S probably benign Het
B4galnt2 T A 11: 95,891,921 M22L probably benign Het
Bcdin3d T C 15: 99,470,815 T168A probably damaging Het
Bmp1 A T 14: 70,490,618 W624R probably damaging Het
Cdh4 C T 2: 179,780,428 A115V probably benign Het
Cfap53 A G 18: 74,300,209 T122A probably damaging Het
Chsy1 A G 7: 66,110,193 K95E probably benign Het
Csde1 C A 3: 103,052,868 P604T probably damaging Het
Cts7 A T 13: 61,355,003 L237Q probably damaging Het
Cutal C T 2: 34,885,921 T88I probably benign Het
Dlg4 G T 11: 70,023,953 probably benign Het
Dnah7c C A 1: 46,649,340 T1890K probably benign Het
Dnah7c A G 1: 46,649,351 S1894G probably benign Het
Eif2b4 C T 5: 31,192,207 E53K possibly damaging Het
Erp44 T C 4: 48,205,130 I288V probably null Het
Fcamr A G 1: 130,813,202 T453A possibly damaging Het
Glb1l3 T C 9: 26,859,588 T61A probably benign Het
Gpr26 T C 7: 131,984,101 S267P probably benign Het
Heatr6 A T 11: 83,759,365 T216S probably benign Het
Hephl1 C T 9: 15,081,964 V525I probably damaging Het
Jak2 T A 19: 29,288,710 I517N probably benign Het
Kbtbd4 T A 2: 90,909,769 Y499* probably null Het
Kif1a A T 1: 93,077,698 I118N probably damaging Het
Klhdc7b A G 15: 89,387,089 S725G probably benign Het
Mfsd13a T C 19: 46,367,866 F137L probably damaging Het
Myo7a T A 7: 98,054,503 Y1977F probably damaging Het
Naip2 C T 13: 100,152,136 V1194I probably benign Het
Naip2 T G 13: 100,161,844 K561N probably benign Het
Nkx2-4 G T 2: 147,083,940 A334E possibly damaging Het
Olfr1507 C T 14: 52,490,793 R57Q probably benign Het
Olfr30 A T 11: 58,455,568 I127N probably damaging Het
Olfr44 A G 9: 39,484,752 V164A probably benign Het
Pcdha7 A G 18: 36,974,486 Q188R probably benign Het
Phf3 A T 1: 30,805,023 S1618R possibly damaging Het
Phip C A 9: 82,900,741 E884* probably null Het
Plxnc1 C A 10: 94,943,876 V235L probably damaging Het
Qser1 A G 2: 104,780,260 V1226A possibly damaging Het
Ros1 G T 10: 52,142,203 S786R probably damaging Het
Rps6ka5 A G 12: 100,551,536 S769P probably damaging Het
Sfxn3 G A 19: 45,049,915 probably null Het
Specc1 T G 11: 62,146,418 S813A probably damaging Het
Spry1 T C 3: 37,642,722 I38T probably damaging Het
Tagap T C 17: 7,933,714 V577A probably benign Het
Tmem44 T C 16: 30,537,551 D110G probably damaging Het
Ubn2 A G 6: 38,434,462 E97G possibly damaging Het
Ubr4 C A 4: 139,473,624 H4706Q possibly damaging Het
Usp25 T A 16: 77,059,288 N256K probably benign Het
Vmn2r112 T A 17: 22,601,179 L11Q probably null Het
Wnt2b C A 3: 104,953,186 R135L probably damaging Het
Zfp60 T C 7: 27,748,726 F273S probably benign Het
Other mutations in Nlrp9c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00489:Nlrp9c APN 7 26384588 missense probably benign 0.00
IGL00814:Nlrp9c APN 7 26384750 missense probably benign 0.23
IGL00919:Nlrp9c APN 7 26394056 nonsense probably null
IGL01762:Nlrp9c APN 7 26385425 missense probably damaging 1.00
IGL01928:Nlrp9c APN 7 26375422 splice site probably benign
IGL02008:Nlrp9c APN 7 26385151 missense probably benign 0.16
IGL02389:Nlrp9c APN 7 26394207 missense probably benign
IGL02535:Nlrp9c APN 7 26372097 missense probably damaging 1.00
IGL02685:Nlrp9c APN 7 26385557 missense probably damaging 0.98
IGL02904:Nlrp9c APN 7 26375290 missense probably damaging 1.00
IGL02935:Nlrp9c APN 7 26385276 missense probably benign 0.00
IGL03006:Nlrp9c APN 7 26372082 missense probably damaging 0.98
IGL03140:Nlrp9c APN 7 26380489 missense probably benign 0.30
IGL03201:Nlrp9c APN 7 26385108 missense probably benign 0.00
IGL03243:Nlrp9c APN 7 26365032 missense probably damaging 0.99
IGL03054:Nlrp9c UTSW 7 26382276 splice site probably null
K7894:Nlrp9c UTSW 7 26384898 missense possibly damaging 0.94
R0018:Nlrp9c UTSW 7 26371998 missense possibly damaging 0.89
R0018:Nlrp9c UTSW 7 26371998 missense possibly damaging 0.89
R0238:Nlrp9c UTSW 7 26378012 missense possibly damaging 0.90
R0238:Nlrp9c UTSW 7 26378012 missense possibly damaging 0.90
R0335:Nlrp9c UTSW 7 26394136 missense possibly damaging 0.92
R0391:Nlrp9c UTSW 7 26371476 splice site probably benign
R0433:Nlrp9c UTSW 7 26385819 missense probably benign 0.20
R1035:Nlrp9c UTSW 7 26371277 splice site probably benign
R1118:Nlrp9c UTSW 7 26384437 missense probably benign 0.01
R1119:Nlrp9c UTSW 7 26384437 missense probably benign 0.01
R1173:Nlrp9c UTSW 7 26380435 missense probably damaging 1.00
R1519:Nlrp9c UTSW 7 26378101 missense possibly damaging 0.88
R1528:Nlrp9c UTSW 7 26382298 missense probably damaging 0.99
R1616:Nlrp9c UTSW 7 26384437 missense probably benign 0.01
R1774:Nlrp9c UTSW 7 26394118 missense probably benign 0.05
R1789:Nlrp9c UTSW 7 26380490 missense probably benign 0.00
R1869:Nlrp9c UTSW 7 26384820 nonsense probably null
R1870:Nlrp9c UTSW 7 26384820 nonsense probably null
R1920:Nlrp9c UTSW 7 26384894 missense probably damaging 1.00
R1987:Nlrp9c UTSW 7 26378056 missense probably benign 0.31
R2022:Nlrp9c UTSW 7 26384796 missense probably damaging 1.00
R2309:Nlrp9c UTSW 7 26378087 missense probably damaging 1.00
R2327:Nlrp9c UTSW 7 26375322 missense probably damaging 1.00
R3405:Nlrp9c UTSW 7 26385282 missense probably benign 0.01
R3548:Nlrp9c UTSW 7 26371451 missense probably damaging 1.00
R3846:Nlrp9c UTSW 7 26382276 splice site probably null
R4179:Nlrp9c UTSW 7 26384661 missense possibly damaging 0.74
R4460:Nlrp9c UTSW 7 26378098 missense probably damaging 1.00
R4669:Nlrp9c UTSW 7 26375368 missense possibly damaging 0.90
R4708:Nlrp9c UTSW 7 26384840 missense probably benign 0.07
R4810:Nlrp9c UTSW 7 26378177 splice site probably null
R4824:Nlrp9c UTSW 7 26380564 missense possibly damaging 0.49
R4915:Nlrp9c UTSW 7 26384460 missense probably benign 0.34
R4996:Nlrp9c UTSW 7 26385747 missense possibly damaging 0.92
R5468:Nlrp9c UTSW 7 26365000 missense probably benign 0.00
R5525:Nlrp9c UTSW 7 26384501 missense probably damaging 1.00
R5526:Nlrp9c UTSW 7 26382366 missense possibly damaging 0.95
R6020:Nlrp9c UTSW 7 26384725 missense probably benign 0.08
R6175:Nlrp9c UTSW 7 26378001 splice site probably null
R6454:Nlrp9c UTSW 7 26385774 missense possibly damaging 0.91
R6493:Nlrp9c UTSW 7 26382387 missense probably damaging 1.00
R6649:Nlrp9c UTSW 7 26371322 missense probably damaging 1.00
R6739:Nlrp9c UTSW 7 26385425 missense probably damaging 0.99
R6883:Nlrp9c UTSW 7 26378131 missense probably benign 0.18
R7097:Nlrp9c UTSW 7 26385621 missense probably damaging 1.00
R7122:Nlrp9c UTSW 7 26385621 missense probably damaging 1.00
R7174:Nlrp9c UTSW 7 26385297 missense probably benign 0.03
R7365:Nlrp9c UTSW 7 26371397 missense possibly damaging 0.93
R7378:Nlrp9c UTSW 7 26365015 missense probably benign 0.14
R7427:Nlrp9c UTSW 7 26371435 missense probably benign 0.00
R7450:Nlrp9c UTSW 7 26364939 missense probably benign 0.45
X0065:Nlrp9c UTSW 7 26380430 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TACCATAGGATGATTACCCATGAGTG -3'
(R):5'- TGATTAGATGCCTAGAACTGGC -3'

Sequencing Primer
(F):5'- CCCATGAGTGCATAGGTATCAATCTG -3'
(R):5'- TTAGATGCCTAGAACTGGCACTGAAC -3'
Posted On2018-07-23