Incidental Mutation 'R6653:Eif2b4'
ID526503
Institutional Source Beutler Lab
Gene Symbol Eif2b4
Ensembl Gene ENSMUSG00000029145
Gene Nameeukaryotic translation initiation factor 2B, subunit 4 delta
SynonymsEif2b
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6653 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location31187558-31193430 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 31192207 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Lysine at position 53 (E53K)
Ref Sequence ENSEMBL: ENSMUSP00000076875 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031029] [ENSMUST00000077693] [ENSMUST00000114603] [ENSMUST00000166769] [ENSMUST00000200730] [ENSMUST00000201154] [ENSMUST00000202758] [ENSMUST00000202124] [ENSMUST00000201535] [ENSMUST00000201679]
Predicted Effect probably benign
Transcript: ENSMUST00000031029
SMART Domains Protein: ENSMUSP00000031029
Gene: ENSMUSG00000029146

DomainStartEndE-ValueType
PX 1 105 3.42e-24 SMART
B41 113 274 4.05e-2 SMART
low complexity region 324 342 N/A INTRINSIC
low complexity region 428 441 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000077693
AA Change: E53K

PolyPhen 2 Score 0.888 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000076875
Gene: ENSMUSG00000029145
AA Change: E53K

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
coiled coil region 29 60 N/A INTRINSIC
coiled coil region 93 122 N/A INTRINSIC
Pfam:IF-2B 219 510 3.4e-97 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000114603
AA Change: E73K

PolyPhen 2 Score 0.885 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000110250
Gene: ENSMUSG00000029145
AA Change: E73K

DomainStartEndE-ValueType
low complexity region 11 26 N/A INTRINSIC
coiled coil region 49 80 N/A INTRINSIC
coiled coil region 113 142 N/A INTRINSIC
Pfam:IF-2B 239 530 3.8e-97 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000166769
AA Change: E73K

PolyPhen 2 Score 0.885 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000130880
Gene: ENSMUSG00000029145
AA Change: E73K

DomainStartEndE-ValueType
low complexity region 11 26 N/A INTRINSIC
coiled coil region 49 80 N/A INTRINSIC
coiled coil region 113 142 N/A INTRINSIC
Pfam:IF-2B 239 530 3.8e-97 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000200724
Predicted Effect probably benign
Transcript: ENSMUST00000200730
SMART Domains Protein: ENSMUSP00000144504
Gene: ENSMUSG00000029146

DomainStartEndE-ValueType
PX 1 87 2.3e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000200741
Predicted Effect probably benign
Transcript: ENSMUST00000200929
Predicted Effect probably benign
Transcript: ENSMUST00000200977
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200983
Predicted Effect possibly damaging
Transcript: ENSMUST00000201154
AA Change: E73K

PolyPhen 2 Score 0.659 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000143802
Gene: ENSMUSG00000029145
AA Change: E73K

DomainStartEndE-ValueType
low complexity region 11 26 N/A INTRINSIC
coiled coil region 49 80 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201343
Predicted Effect possibly damaging
Transcript: ENSMUST00000202758
AA Change: E95K

PolyPhen 2 Score 0.816 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000144361
Gene: ENSMUSG00000029145
AA Change: E95K

DomainStartEndE-ValueType
coiled coil region 71 102 N/A INTRINSIC
coiled coil region 135 164 N/A INTRINSIC
Pfam:IF-2B 261 552 2.3e-97 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202743
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201835
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202032
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202318
Predicted Effect probably benign
Transcript: ENSMUST00000202124
SMART Domains Protein: ENSMUSP00000144168
Gene: ENSMUSG00000029146

DomainStartEndE-ValueType
Blast:PX 1 31 6e-8 BLAST
PDB:3LUI|C 1 31 4e-9 PDB
low complexity region 41 54 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202323
Predicted Effect probably benign
Transcript: ENSMUST00000201535
SMART Domains Protein: ENSMUSP00000144643
Gene: ENSMUSG00000029146

DomainStartEndE-ValueType
Blast:PX 1 23 3e-7 BLAST
PDB:3LUI|C 1 23 3e-8 PDB
low complexity region 24 35 N/A INTRINSIC
Blast:B41 36 169 5e-92 BLAST
PDB:4GXB|A 36 169 4e-90 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202468
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202616
Predicted Effect probably benign
Transcript: ENSMUST00000201679
SMART Domains Protein: ENSMUSP00000144688
Gene: ENSMUSG00000029146

DomainStartEndE-ValueType
Pfam:PX 6 67 2.7e-9 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Eukaryotic initiation factor 2B (EIF2B), which is necessary for protein synthesis, is a GTP exchange factor composed of five different subunits. The protein encoded by this gene is the fourth, or delta, subunit. Defects in this gene are a cause of leukoencephalopathy with vanishing white matter (VWM) and ovarioleukodystrophy. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca15 T G 7: 120,346,006 L435R probably benign Het
Abcc2 T A 19: 43,812,502 H627Q probably benign Het
Ankhd1 A T 18: 36,600,783 probably null Het
Ankrd50 T A 3: 38,457,361 I286F probably damaging Het
Asb15 A G 6: 24,562,633 N198S probably benign Het
B4galnt2 T A 11: 95,891,921 M22L probably benign Het
Bcdin3d T C 15: 99,470,815 T168A probably damaging Het
Bmp1 A T 14: 70,490,618 W624R probably damaging Het
Cdh4 C T 2: 179,780,428 A115V probably benign Het
Cfap53 A G 18: 74,300,209 T122A probably damaging Het
Chsy1 A G 7: 66,110,193 K95E probably benign Het
Csde1 C A 3: 103,052,868 P604T probably damaging Het
Cts7 A T 13: 61,355,003 L237Q probably damaging Het
Cutal C T 2: 34,885,921 T88I probably benign Het
Dlg4 G T 11: 70,023,953 probably benign Het
Dnah7c C A 1: 46,649,340 T1890K probably benign Het
Dnah7c A G 1: 46,649,351 S1894G probably benign Het
Erp44 T C 4: 48,205,130 I288V probably null Het
Fcamr A G 1: 130,813,202 T453A possibly damaging Het
Glb1l3 T C 9: 26,859,588 T61A probably benign Het
Gpr26 T C 7: 131,984,101 S267P probably benign Het
Heatr6 A T 11: 83,759,365 T216S probably benign Het
Hephl1 C T 9: 15,081,964 V525I probably damaging Het
Jak2 T A 19: 29,288,710 I517N probably benign Het
Kbtbd4 T A 2: 90,909,769 Y499* probably null Het
Kif1a A T 1: 93,077,698 I118N probably damaging Het
Klhdc7b A G 15: 89,387,089 S725G probably benign Het
Mfsd13a T C 19: 46,367,866 F137L probably damaging Het
Myo7a T A 7: 98,054,503 Y1977F probably damaging Het
Naip2 C T 13: 100,152,136 V1194I probably benign Het
Naip2 T G 13: 100,161,844 K561N probably benign Het
Nkx2-4 G T 2: 147,083,940 A334E possibly damaging Het
Nlrp9c T A 7: 26,371,322 N945Y probably damaging Het
Olfr1507 C T 14: 52,490,793 R57Q probably benign Het
Olfr30 A T 11: 58,455,568 I127N probably damaging Het
Olfr44 A G 9: 39,484,752 V164A probably benign Het
Pcdha7 A G 18: 36,974,486 Q188R probably benign Het
Phf3 A T 1: 30,805,023 S1618R possibly damaging Het
Phip C A 9: 82,900,741 E884* probably null Het
Plxnc1 C A 10: 94,943,876 V235L probably damaging Het
Qser1 A G 2: 104,780,260 V1226A possibly damaging Het
Ros1 G T 10: 52,142,203 S786R probably damaging Het
Rps6ka5 A G 12: 100,551,536 S769P probably damaging Het
Sfxn3 G A 19: 45,049,915 probably null Het
Specc1 T G 11: 62,146,418 S813A probably damaging Het
Spry1 T C 3: 37,642,722 I38T probably damaging Het
Tagap T C 17: 7,933,714 V577A probably benign Het
Tmem44 T C 16: 30,537,551 D110G probably damaging Het
Ubn2 A G 6: 38,434,462 E97G possibly damaging Het
Ubr4 C A 4: 139,473,624 H4706Q possibly damaging Het
Usp25 T A 16: 77,059,288 N256K probably benign Het
Vmn2r112 T A 17: 22,601,179 L11Q probably null Het
Wnt2b C A 3: 104,953,186 R135L probably damaging Het
Zfp60 T C 7: 27,748,726 F273S probably benign Het
Other mutations in Eif2b4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01469:Eif2b4 APN 5 31187767 missense probably benign 0.02
IGL02525:Eif2b4 APN 5 31189618 missense probably damaging 0.99
IGL03178:Eif2b4 APN 5 31187653 missense probably damaging 1.00
IGL03267:Eif2b4 APN 5 31192659 missense possibly damaging 0.90
IGL03379:Eif2b4 APN 5 31190011 splice site probably benign
IGL03397:Eif2b4 APN 5 31187653 missense probably damaging 1.00
R0346:Eif2b4 UTSW 5 31188108 splice site probably benign
R1549:Eif2b4 UTSW 5 31192921 missense possibly damaging 0.72
R1636:Eif2b4 UTSW 5 31192266 splice site probably null
R1753:Eif2b4 UTSW 5 31192940 missense probably benign 0.00
R2263:Eif2b4 UTSW 5 31192574 splice site probably benign
R2317:Eif2b4 UTSW 5 31191576 splice site probably null
R3808:Eif2b4 UTSW 5 31191168 missense possibly damaging 0.95
R3809:Eif2b4 UTSW 5 31191168 missense possibly damaging 0.95
R4746:Eif2b4 UTSW 5 31187653 missense probably damaging 1.00
R4752:Eif2b4 UTSW 5 31191231 nonsense probably null
R4798:Eif2b4 UTSW 5 31189520 intron probably benign
R4895:Eif2b4 UTSW 5 31192954 missense probably benign 0.00
R4936:Eif2b4 UTSW 5 31192897 missense probably benign 0.00
R5588:Eif2b4 UTSW 5 31192173 nonsense probably null
R5660:Eif2b4 UTSW 5 31191156 missense probably benign 0.00
R6363:Eif2b4 UTSW 5 31191239 missense probably damaging 0.99
R6750:Eif2b4 UTSW 5 31189960 missense probably damaging 0.99
R7062:Eif2b4 UTSW 5 31192831 missense probably benign
R7221:Eif2b4 UTSW 5 31187787 missense possibly damaging 0.55
R7360:Eif2b4 UTSW 5 31191375 missense probably benign 0.08
R7779:Eif2b4 UTSW 5 31190654 missense probably damaging 1.00
R8683:Eif2b4 UTSW 5 31187930 missense probably damaging 1.00
R8848:Eif2b4 UTSW 5 31190866 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CTCTGCCTTCCAAGTAACCG -3'
(R):5'- GACTATGACTGAAGAAGTTTCTCTCC -3'

Sequencing Primer
(F):5'- AAGTAACCGCTTTTGTACTTGC -3'
(R):5'- CAGAGAGTGTTAGGAACTTAACCTTG -3'
Posted On2018-07-23