Incidental Mutation 'R0346:Eif2b4'
Institutional Source Beutler Lab
Gene Symbol Eif2b4
Ensembl Gene ENSMUSG00000029145
Gene Nameeukaryotic translation initiation factor 2B, subunit 4 delta
MMRRC Submission 038553-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0346 (G1)
Quality Score225
Status Validated
Chromosomal Location31187558-31193430 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to G at 31188108 bp
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000144361 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077693] [ENSMUST00000114603] [ENSMUST00000166769] [ENSMUST00000201154] [ENSMUST00000202758]
Predicted Effect probably benign
Transcript: ENSMUST00000077693
SMART Domains Protein: ENSMUSP00000076875
Gene: ENSMUSG00000029145

low complexity region 2 15 N/A INTRINSIC
coiled coil region 29 60 N/A INTRINSIC
coiled coil region 93 122 N/A INTRINSIC
Pfam:IF-2B 219 510 3.4e-97 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000114603
SMART Domains Protein: ENSMUSP00000110250
Gene: ENSMUSG00000029145

low complexity region 11 26 N/A INTRINSIC
coiled coil region 49 80 N/A INTRINSIC
coiled coil region 113 142 N/A INTRINSIC
Pfam:IF-2B 239 530 3.8e-97 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000114605
SMART Domains Protein: ENSMUSP00000110252
Gene: ENSMUSG00000029145

coiled coil region 71 102 N/A INTRINSIC
coiled coil region 135 164 N/A INTRINSIC
Pfam:IF-2B 261 552 2.3e-97 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000166769
SMART Domains Protein: ENSMUSP00000130880
Gene: ENSMUSG00000029145

low complexity region 11 26 N/A INTRINSIC
coiled coil region 49 80 N/A INTRINSIC
coiled coil region 113 142 N/A INTRINSIC
Pfam:IF-2B 239 530 3.8e-97 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000200724
Predicted Effect probably benign
Transcript: ENSMUST00000200741
Predicted Effect probably benign
Transcript: ENSMUST00000200929
Predicted Effect probably benign
Transcript: ENSMUST00000200977
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200983
Predicted Effect probably benign
Transcript: ENSMUST00000201154
SMART Domains Protein: ENSMUSP00000143802
Gene: ENSMUSG00000029145

low complexity region 11 26 N/A INTRINSIC
coiled coil region 49 80 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202468
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202616
Predicted Effect probably benign
Transcript: ENSMUST00000202758
SMART Domains Protein: ENSMUSP00000144361
Gene: ENSMUSG00000029145

coiled coil region 71 102 N/A INTRINSIC
coiled coil region 135 164 N/A INTRINSIC
Pfam:IF-2B 261 552 2.3e-97 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.9%
  • 10x: 97.7%
  • 20x: 96.4%
Validation Efficiency 100% (79/79)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Eukaryotic initiation factor 2B (EIF2B), which is necessary for protein synthesis, is a GTP exchange factor composed of five different subunits. The protein encoded by this gene is the fourth, or delta, subunit. Defects in this gene are a cause of leukoencephalopathy with vanishing white matter (VWM) and ovarioleukodystrophy. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A T 11: 9,566,278 I4406L probably damaging Het
Abca16 T A 7: 120,435,932 C314S probably damaging Het
Add3 C T 19: 53,216,956 R46* probably null Het
Alas1 A T 9: 106,243,351 S82T possibly damaging Het
Alkbh5 C G 11: 60,538,741 R107G possibly damaging Het
Ap3b1 A T 13: 94,445,971 R365* probably null Het
Ass1 A T 2: 31,514,819 N371Y probably damaging Het
AU021092 T C 16: 5,216,854 D168G possibly damaging Het
Bcl2 G A 1: 106,712,562 R107C probably damaging Het
Caln1 C A 5: 130,822,921 H184N possibly damaging Het
Camta1 C A 4: 151,075,140 R1614L probably damaging Het
Ccdc191 T C 16: 43,938,952 V372A probably damaging Het
Ccng2 T G 5: 93,270,894 I126S probably damaging Het
Cep85 A T 4: 134,132,422 N643K probably damaging Het
Clvs2 G C 10: 33,622,546 S129R possibly damaging Het
Cntn1 G T 15: 92,232,087 probably benign Het
Cttn A T 7: 144,452,539 probably benign Het
Dedd2 T C 7: 25,211,269 S161G possibly damaging Het
Dnajb13 T C 7: 100,503,925 D263G probably damaging Het
Dppa4 T A 16: 48,289,324 probably benign Het
Ear2 A G 14: 44,102,906 E7G probably damaging Het
Etl4 G T 2: 20,759,652 probably null Het
Fbxo15 T A 18: 84,960,221 probably null Het
Gm8765 T C 13: 50,703,310 Y995H probably benign Het
Gm9970 A G 5: 31,240,838 probably benign Het
Hap1 A G 11: 100,356,029 S17P probably benign Het
Hgd C T 16: 37,588,774 probably benign Het
Inpp5f T A 7: 128,690,668 L16Q probably damaging Het
Islr2 G A 9: 58,198,343 R545* probably null Het
Itgav G T 2: 83,792,609 C675F probably damaging Het
Kif13a T A 13: 46,814,219 I403L possibly damaging Het
Kif14 T A 1: 136,468,160 I68N probably damaging Het
Kif26a G T 12: 112,179,348 K1764N probably null Het
Lrrd1 C A 5: 3,850,215 F173L probably benign Het
Mroh4 G C 15: 74,614,292 probably benign Het
Mrvi1 T C 7: 110,898,976 D404G probably damaging Het
Msh5 A G 17: 35,029,888 V723A probably benign Het
Mybph T G 1: 134,197,754 I279S probably damaging Het
Myh4 A T 11: 67,260,326 I1936L probably benign Het
Myo1h A T 5: 114,355,209 T704S probably benign Het
Nav2 C A 7: 49,604,585 T2377K probably benign Het
Nipbl T G 15: 8,360,956 Q276H probably damaging Het
Nlrp9b T C 7: 20,024,515 L559P probably damaging Het
Nup210l T A 3: 90,189,438 V1318E probably damaging Het
Olfr1427 A T 19: 12,099,439 S67T probably damaging Het
Olfr18 A G 9: 20,314,411 S170P probably benign Het
Olfr385 A G 11: 73,589,457 Y94H probably damaging Het
Olfr765 C A 10: 129,046,473 V197F possibly damaging Het
P2ry13 T C 3: 59,209,566 T264A possibly damaging Het
Plekhg5 T C 4: 152,114,253 L966P probably benign Het
Prss35 A G 9: 86,755,351 K58R probably benign Het
Ptafr T A 4: 132,580,079 L260* probably null Het
Pum1 A T 4: 130,779,805 T1157S possibly damaging Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Rnf145 A G 11: 44,555,164 Y275C probably damaging Het
Rpl6 A T 5: 121,208,491 K218N possibly damaging Het
Rps6 T C 4: 86,855,981 T128A probably benign Het
Ryr1 G T 7: 29,067,588 probably benign Het
Scel A T 14: 103,529,984 Q26H probably damaging Het
Sfxn4 A T 19: 60,858,673 D57E probably benign Het
Slc35d1 A C 4: 103,190,847 L240R probably damaging Het
Smcr8 A G 11: 60,779,750 I575V probably benign Het
Syk G A 13: 52,640,659 M476I probably damaging Het
Tbcel A T 9: 42,437,243 probably benign Het
Tob2 C A 15: 81,858,223 G65W probably damaging Het
Trim16 A G 11: 62,840,694 N464D probably benign Het
Trim36 T C 18: 46,199,709 probably benign Het
Trpv4 C A 5: 114,630,529 probably benign Het
Tsga10 T A 1: 37,840,519 T64S possibly damaging Het
Ttc26 T C 6: 38,409,435 C364R probably damaging Het
Vars2 A T 17: 35,664,864 probably benign Het
Vmn1r72 C A 7: 11,669,694 V276L probably benign Het
Vps13a T A 19: 16,677,969 K1898N probably benign Het
Vps18 A G 2: 119,297,164 M823V probably damaging Het
Washc2 T C 6: 116,220,523 probably benign Het
Zfp763 A T 17: 33,019,747 H141Q probably benign Het
Other mutations in Eif2b4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01469:Eif2b4 APN 5 31187767 missense probably benign 0.02
IGL02525:Eif2b4 APN 5 31189618 missense probably damaging 0.99
IGL03178:Eif2b4 APN 5 31187653 missense probably damaging 1.00
IGL03267:Eif2b4 APN 5 31192659 missense possibly damaging 0.90
IGL03379:Eif2b4 APN 5 31190011 splice site probably benign
IGL03397:Eif2b4 APN 5 31187653 missense probably damaging 1.00
R1549:Eif2b4 UTSW 5 31192921 missense possibly damaging 0.72
R1636:Eif2b4 UTSW 5 31192266 splice site probably null
R1753:Eif2b4 UTSW 5 31192940 missense probably benign 0.00
R2263:Eif2b4 UTSW 5 31192574 splice site probably benign
R2317:Eif2b4 UTSW 5 31191576 splice site probably null
R3808:Eif2b4 UTSW 5 31191168 missense possibly damaging 0.95
R3809:Eif2b4 UTSW 5 31191168 missense possibly damaging 0.95
R4746:Eif2b4 UTSW 5 31187653 missense probably damaging 1.00
R4752:Eif2b4 UTSW 5 31191231 nonsense probably null
R4798:Eif2b4 UTSW 5 31189520 intron probably benign
R4895:Eif2b4 UTSW 5 31192954 missense probably benign 0.00
R4936:Eif2b4 UTSW 5 31192897 missense probably benign 0.00
R5588:Eif2b4 UTSW 5 31192173 nonsense probably null
R5660:Eif2b4 UTSW 5 31191156 missense probably benign 0.00
R6363:Eif2b4 UTSW 5 31191239 missense probably damaging 0.99
R6653:Eif2b4 UTSW 5 31192207 missense possibly damaging 0.89
R6750:Eif2b4 UTSW 5 31189960 missense probably damaging 0.99
R7062:Eif2b4 UTSW 5 31192831 missense probably benign
R7221:Eif2b4 UTSW 5 31187787 missense possibly damaging 0.55
R7360:Eif2b4 UTSW 5 31191375 missense probably benign 0.08
R7779:Eif2b4 UTSW 5 31190654 missense probably damaging 1.00
Predicted Primers PCR Primer
(R):5'- ccaccacacccTACACTTTGATCC -3'

Sequencing Primer
(R):5'- aaagcctgtctcaaaaagcc -3'
Posted On2013-05-09