Incidental Mutation 'R6728:Barhl1'
ID529935
Institutional Source Beutler Lab
Gene Symbol Barhl1
Ensembl Gene ENSMUSG00000026805
Gene NameBarH like homeobox 1
SynonymsDres115, MBH2
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.258) question?
Stock #R6728 (G1)
Quality Score190.009
Status Not validated
Chromosome2
Chromosomal Location28907679-28916668 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 28915483 bp
ZygosityHeterozygous
Amino Acid Change Proline to Leucine at position 66 (P66L)
Ref Sequence ENSEMBL: ENSMUSP00000109480 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050776] [ENSMUST00000113847] [ENSMUST00000113849]
Predicted Effect probably benign
Transcript: ENSMUST00000050776
AA Change: P66L

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000053147
Gene: ENSMUSG00000026805
AA Change: P66L

DomainStartEndE-ValueType
low complexity region 33 54 N/A INTRINSIC
low complexity region 144 152 N/A INTRINSIC
HOX 178 240 4.35e-27 SMART
low complexity region 309 321 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000113847
AA Change: P66L

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000109478
Gene: ENSMUSG00000026805
AA Change: P66L

DomainStartEndE-ValueType
low complexity region 33 54 N/A INTRINSIC
low complexity region 144 152 N/A INTRINSIC
HOX 178 240 4.35e-27 SMART
low complexity region 309 321 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000113849
AA Change: P66L

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000109480
Gene: ENSMUSG00000026805
AA Change: P66L

DomainStartEndE-ValueType
low complexity region 33 54 N/A INTRINSIC
low complexity region 144 152 N/A INTRINSIC
HOX 178 240 4.35e-27 SMART
low complexity region 309 321 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124059
SMART Domains Protein: ENSMUSP00000134363
Gene: ENSMUSG00000026805

DomainStartEndE-ValueType
low complexity region 6 21 N/A INTRINSIC
low complexity region 76 95 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174027
SMART Domains Protein: ENSMUSP00000134118
Gene: ENSMUSG00000026805

DomainStartEndE-ValueType
HOX 1 32 2.5e-3 SMART
low complexity region 101 113 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous mutation of this gene results in progressive hearing loss starting at 2 weeks of age. Animals are completely deaf by 10 months of age and show degeneration of the inner and outer cochlear hair cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik T C 14: 32,662,688 Y440C possibly damaging Het
Acot11 C T 4: 106,760,130 G240R probably damaging Het
Adcy5 T A 16: 35,157,165 V356E possibly damaging Het
Agmat G T 4: 141,749,586 C101F probably benign Het
Atl1 T C 12: 69,947,550 V276A possibly damaging Het
Camk4 A T 18: 33,184,939 E383V probably benign Het
Cap2 G A 13: 46,639,859 E234K possibly damaging Het
Col24a1 A T 3: 145,315,196 M443L probably benign Het
Cyp17a1 A G 19: 46,669,234 V293A probably benign Het
Epha6 C A 16: 60,424,835 A334S possibly damaging Het
Frmpd1 T C 4: 45,284,664 S1162P probably benign Het
Hspbp1 T A 7: 4,660,782 M355L possibly damaging Het
Insrr C T 3: 87,813,566 R1044C probably damaging Het
Kin G A 2: 10,090,148 R82Q possibly damaging Het
Ninl G T 2: 150,975,857 S129* probably null Het
Olfr1277 A T 2: 111,269,673 D231E probably benign Het
Olfr749 T C 14: 50,736,839 T108A possibly damaging Het
Paqr5 C T 9: 61,963,783 R171Q probably damaging Het
Platr25 G A 13: 62,700,383 H222Y probably damaging Het
Plcb2 G T 2: 118,723,690 S94Y probably damaging Het
Rock2 T C 12: 16,961,736 Y722H probably benign Het
Sh3kbp1 A T X: 159,841,180 E39D probably benign Homo
Svs1 T C 6: 48,988,845 S596P possibly damaging Het
Thsd4 T C 9: 59,997,197 D572G probably benign Het
Tnrc6b T A 15: 80,918,526 L1510H probably damaging Het
Tsc2 A G 17: 24,621,124 S433P probably damaging Het
Vegfc T C 8: 54,186,022 V401A probably damaging Het
Vwa3b A G 1: 37,157,372 M27V probably damaging Het
Other mutations in Barhl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01323:Barhl1 APN 2 28915546 missense probably benign 0.03
IGL02337:Barhl1 APN 2 28911419 missense probably damaging 1.00
IGL03113:Barhl1 APN 2 28915456 missense probably benign 0.03
R0449:Barhl1 UTSW 2 28915292 missense probably benign 0.06
R1675:Barhl1 UTSW 2 28915411 missense possibly damaging 0.86
R1829:Barhl1 UTSW 2 28909845 missense probably damaging 1.00
R3615:Barhl1 UTSW 2 28911550 missense possibly damaging 0.75
R3616:Barhl1 UTSW 2 28911550 missense possibly damaging 0.75
R4937:Barhl1 UTSW 2 28909773 missense probably damaging 1.00
R5481:Barhl1 UTSW 2 28915340 missense probably damaging 0.98
R6075:Barhl1 UTSW 2 28915219 missense probably damaging 0.99
R6727:Barhl1 UTSW 2 28915483 missense probably benign 0.01
R7096:Barhl1 UTSW 2 28909714 missense probably benign
R7123:Barhl1 UTSW 2 28909931 splice site probably null
R7336:Barhl1 UTSW 2 28909843 missense probably benign 0.40
R7339:Barhl1 UTSW 2 28909887 missense probably damaging 1.00
R7584:Barhl1 UTSW 2 28909791 missense probably damaging 0.99
X0065:Barhl1 UTSW 2 28915339 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CAGCTTGTCTCGAAAGTCCTC -3'
(R):5'- GGCTTTGGGATTGACTCCATTC -3'

Sequencing Primer
(F):5'- TCTCGAAAGTCCTCCCCGG -3'
(R):5'- ATTCTCTCCCACCGAGCGG -3'
Posted On2018-08-01