Incidental Mutation 'R6757:Dntt'
ID531101
Institutional Source Beutler Lab
Gene Symbol Dntt
Ensembl Gene ENSMUSG00000025014
Gene Namedeoxynucleotidyltransferase, terminal
SynonymsTdt
MMRRC Submission
Accession Numbers

Genbank: NM_009345 ; MGI: 98659

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6757 (G1)
Quality Score225.009
Status Not validated
Chromosome19
Chromosomal Location41029275-41059523 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 41037162 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 73 (H73L)
Ref Sequence ENSEMBL: ENSMUSP00000107819 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051806] [ENSMUST00000112200]
Predicted Effect probably damaging
Transcript: ENSMUST00000051806
AA Change: H73L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000062078
Gene: ENSMUSG00000025014
AA Change: H73L

DomainStartEndE-ValueType
BRCT 29 114 3.05e-9 SMART
POLXc 163 529 5.68e-196 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000112200
AA Change: H73L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000107819
Gene: ENSMUSG00000025014
AA Change: H73L

DomainStartEndE-ValueType
BRCT 29 114 3.05e-9 SMART
POLXc 163 509 1.19e-198 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the DNA polymerase type-X family and encodes a template-independent DNA polymerase that catalyzes the addition of deoxynucleotides to the 3'-hydroxyl terminus of oligonucleotide primers. In vivo, the encoded protein is expressed in a restricted population of normal and malignant pre-B and pre-T lymphocytes during early differentiation, where it generates antigen receptor diversity by synthesizing non-germ line elements (N-regions) at the junctions of rearranged Ig heavy chain and T cell receptor gene segments. Alternatively spliced transcript variants encoding different isoforms of this gene have been described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous inactivation of this gene results in lack of "N" nucleotide insertions at the junctions of immunoglobulin and T cell receptor V(D)J rearrangements. Forced expression of terminal deoxynucleotidyl transferase in fetal thymus leads to decreased gamma-delta T cell number. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted, knock-out(2) Targeted, other(2)

Other mutations in this stock
Total: 22 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931406P16Rik G A 7: 34,239,077 A799V possibly damaging Het
A830018L16Rik A T 1: 11,596,334 *288Y probably null Het
Art2a-ps G T 7: 101,555,014 L106I probably benign Het
Bmi1 C T 2: 18,684,029 T203M probably damaging Het
Cpm A G 10: 117,671,638 D220G probably damaging Het
Cyp2a22 A C 7: 26,939,204 D52E probably benign Het
Dag1 A C 9: 108,218,017 I92S probably damaging Het
Epha5 A C 5: 84,105,878 I716S probably damaging Het
Fpr-rs4 C T 17: 18,022,132 Q134* probably null Het
Fzd8 T A 18: 9,213,238 C107S possibly damaging Het
Gm597 A C 1: 28,780,110 I30S probably damaging Het
Gnptab T C 10: 88,437,502 L1047P probably damaging Het
Gstt1 A T 10: 75,798,383 probably null Het
Kdm2a T C 19: 4,319,243 R1115G probably damaging Het
Myl10 G C 5: 136,697,971 V70L probably benign Het
Myo1b C T 1: 51,813,048 E179K probably damaging Het
Nrp1 T A 8: 128,425,868 I186N probably damaging Het
Olfr1512 A G 14: 52,372,715 C113R probably damaging Het
Pole T C 5: 110,303,610 V835A probably damaging Het
Shprh A G 10: 11,181,508 probably null Het
Slc39a14 A T 14: 70,310,884 L238Q probably damaging Het
Usp40 A T 1: 87,980,037 I619N probably damaging Het
Other mutations in Dntt
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00827:Dntt APN 19 41039823 missense probably benign 0.01
IGL01531:Dntt APN 19 41053238 nonsense probably null
IGL01859:Dntt APN 19 41037304 missense probably benign
IGL02053:Dntt APN 19 41046274 missense probably benign 0.00
IGL02411:Dntt APN 19 41052985 splice site probably null
IGL03180:Dntt APN 19 41029551 missense probably benign 0.09
R0106:Dntt UTSW 19 41055746 splice site probably benign
R0122:Dntt UTSW 19 41053038 missense possibly damaging 0.95
R0194:Dntt UTSW 19 41038970 missense possibly damaging 0.90
R0266:Dntt UTSW 19 41059127 missense probably damaging 0.99
R0377:Dntt UTSW 19 41047627 nonsense probably null
R0412:Dntt UTSW 19 41042933 missense probably damaging 1.00
R0604:Dntt UTSW 19 41053149 missense probably benign 0.01
R1350:Dntt UTSW 19 41037139 splice site probably benign
R1577:Dntt UTSW 19 41055785 missense probably damaging 1.00
R1677:Dntt UTSW 19 41029484 missense probably benign 0.26
R2567:Dntt UTSW 19 41041336 missense possibly damaging 0.81
R4380:Dntt UTSW 19 41053233 missense probably damaging 1.00
R4703:Dntt UTSW 19 41039803 missense probably benign 0.00
R4999:Dntt UTSW 19 41039856 missense probably damaging 0.99
R6257:Dntt UTSW 19 41053062 missense probably damaging 1.00
R7340:Dntt UTSW 19 41058565 critical splice acceptor site probably null
R7388:Dntt UTSW 19 41038979 missense probably benign 0.01
R7553:Dntt UTSW 19 41029487 missense probably damaging 0.99
R7806:Dntt UTSW 19 41029632 missense probably benign 0.02
R8145:Dntt UTSW 19 41055785 missense probably damaging 1.00
YA93:Dntt UTSW 19 41053187 missense probably benign
Z1177:Dntt UTSW 19 41055815 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGATGTAGCCTCTAAATTCTCG -3'
(R):5'- TTCTGATGCCCATGCCAGTG -3'

Sequencing Primer
(F):5'- CATGATAAAGCTGGTTTGGC -3'
(R):5'- TGGCCACCCAGCAAAGGAG -3'
Posted On2018-08-01