Incidental Mutation 'R6757:Fpr-rs4'
ID531098
Institutional Source Beutler Lab
Gene Symbol Fpr-rs4
Ensembl Gene ENSMUSG00000048062
Gene Nameformyl peptide receptor, related sequence 4
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.121) question?
Stock #R6757 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location18021733-18022704 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to T at 18022132 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 134 (Q134*)
Ref Sequence ENSEMBL: ENSMUSP00000093311 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095651]
Predicted Effect probably null
Transcript: ENSMUST00000095651
AA Change: Q134*
SMART Domains Protein: ENSMUSP00000093311
Gene: ENSMUSG00000048062
AA Change: Q134*

DomainStartEndE-ValueType
Pfam:7tm_1 43 297 4.9e-35 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.4%
  • 20x: 95.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 22 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931406P16Rik G A 7: 34,239,077 A799V possibly damaging Het
A830018L16Rik A T 1: 11,596,334 *288Y probably null Het
Art2a-ps G T 7: 101,555,014 L106I probably benign Het
Bmi1 C T 2: 18,684,029 T203M probably damaging Het
Cpm A G 10: 117,671,638 D220G probably damaging Het
Cyp2a22 A C 7: 26,939,204 D52E probably benign Het
Dag1 A C 9: 108,218,017 I92S probably damaging Het
Dntt A T 19: 41,037,162 H73L probably damaging Het
Epha5 A C 5: 84,105,878 I716S probably damaging Het
Fzd8 T A 18: 9,213,238 C107S possibly damaging Het
Gm597 A C 1: 28,780,110 I30S probably damaging Het
Gnptab T C 10: 88,437,502 L1047P probably damaging Het
Gstt1 A T 10: 75,798,383 probably null Het
Kdm2a T C 19: 4,319,243 R1115G probably damaging Het
Myl10 G C 5: 136,697,971 V70L probably benign Het
Myo1b C T 1: 51,813,048 E179K probably damaging Het
Nrp1 T A 8: 128,425,868 I186N probably damaging Het
Olfr1512 A G 14: 52,372,715 C113R probably damaging Het
Pole T C 5: 110,303,610 V835A probably damaging Het
Shprh A G 10: 11,181,508 probably null Het
Slc39a14 A T 14: 70,310,884 L238Q probably damaging Het
Usp40 A T 1: 87,980,037 I619N probably damaging Het
Other mutations in Fpr-rs4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00539:Fpr-rs4 APN 17 18021926 missense probably damaging 1.00
IGL01064:Fpr-rs4 APN 17 18022517 missense probably damaging 1.00
IGL01626:Fpr-rs4 APN 17 18022231 missense probably damaging 0.97
IGL02544:Fpr-rs4 APN 17 18022211 missense probably benign
IGL02837:Fpr-rs4 UTSW 17 18022251 missense probably benign 0.00
R0179:Fpr-rs4 UTSW 17 18022027 nonsense probably null
R0383:Fpr-rs4 UTSW 17 18022097 missense probably damaging 1.00
R0686:Fpr-rs4 UTSW 17 18022351 missense probably benign 0.05
R1551:Fpr-rs4 UTSW 17 18022327 missense possibly damaging 0.89
R1956:Fpr-rs4 UTSW 17 18022256 missense probably damaging 0.97
R2040:Fpr-rs4 UTSW 17 18022334 frame shift probably null
R2041:Fpr-rs4 UTSW 17 18022334 frame shift probably null
R2043:Fpr-rs4 UTSW 17 18022334 frame shift probably null
R2045:Fpr-rs4 UTSW 17 18022334 frame shift probably null
R2048:Fpr-rs4 UTSW 17 18022334 frame shift probably null
R2092:Fpr-rs4 UTSW 17 18022334 frame shift probably null
R2093:Fpr-rs4 UTSW 17 18022334 frame shift probably null
R2136:Fpr-rs4 UTSW 17 18022334 frame shift probably null
R3624:Fpr-rs4 UTSW 17 18022334 frame shift probably null
R4684:Fpr-rs4 UTSW 17 18022184 missense probably damaging 1.00
R6076:Fpr-rs4 UTSW 17 18022055 missense probably damaging 1.00
R6247:Fpr-rs4 UTSW 17 18022486 missense probably benign 0.00
R6639:Fpr-rs4 UTSW 17 18022132 nonsense probably null
Z1088:Fpr-rs4 UTSW 17 18021919 missense possibly damaging 0.85
Z1088:Fpr-rs4 UTSW 17 18022694 missense probably benign 0.16
Predicted Primers PCR Primer
(F):5'- ACACACTGTGACCACTGTCTC -3'
(R):5'- CTGCTCTTCAGAGGTTGCAACC -3'

Sequencing Primer
(F):5'- GACCACTGTCTCTTATCTGAACTTGG -3'
(R):5'- GGTTGCAACCCAGGATTCAAATTTAG -3'
Posted On2018-08-01