Incidental Mutation 'R6843:Igkv4-90'
ID534619
Institutional Source Beutler Lab
Gene Symbol Igkv4-90
Ensembl Gene ENSMUSG00000076533
Gene Nameimmunoglobulin kappa chain variable 4-90
SynonymsGm16906
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.191) question?
Stock #R6843 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location68807181-68807684 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 68807686 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 8 (F8S)
Ref Sequence ENSEMBL: ENSMUSP00000100135 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000103334]
Predicted Effect possibly damaging
Transcript: ENSMUST00000103334
AA Change: F8S

PolyPhen 2 Score 0.873 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000100135
Gene: ENSMUSG00000076533
AA Change: F8S

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
IGv 40 111 9.2e-23 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m A T 6: 121,638,401 Q78L probably benign Het
Akr1c21 A G 13: 4,575,214 H48R probably damaging Het
Anks1b T A 10: 90,948,598 S1143T probably damaging Het
Apip T G 2: 103,092,489 F217L probably benign Het
Ash1l T A 3: 88,985,388 Y1525N probably damaging Het
Bcl2l13 G A 6: 120,848,617 probably null Het
Cep85 C G 4: 134,155,856 A241P probably benign Het
Clk4 T G 11: 51,276,249 probably null Het
Cnr2 C T 4: 135,917,589 P326L probably benign Het
Cryaa A G 17: 31,678,173 D58G possibly damaging Het
Crybg3 G A 16: 59,559,796 T365M probably benign Het
Csmd2 A G 4: 128,463,794 N1683D probably benign Het
Dbx2 T G 15: 95,654,459 I102L possibly damaging Het
Dll4 A T 2: 119,325,994 probably benign Het
Epb42 T A 2: 121,027,685 Y264F possibly damaging Het
Exoc3l T A 8: 105,290,097 H695L probably benign Het
Fam160a1 G A 3: 85,673,045 P618S probably damaging Het
Ghsr A C 3: 27,372,527 D244A probably benign Het
Gm9195 A G 14: 72,441,211 Y2268H possibly damaging Het
Hdac1 A G 4: 129,542,590 Y14H probably damaging Het
Hdac3 A T 18: 37,941,954 Y282N probably benign Het
Heg1 T A 16: 33,719,526 N285K probably benign Het
Map2k1 A T 9: 64,187,691 D336E probably damaging Het
Map4k2 A T 19: 6,353,447 I796F probably damaging Het
Mapk13 T A 17: 28,775,453 probably null Het
Mprip A G 11: 59,759,728 I1419M possibly damaging Het
Nrap T C 19: 56,380,219 E255G probably damaging Het
Olfr1306 T C 2: 111,912,915 N5S probably damaging Het
Olfr1357 T C 10: 78,612,057 N195D probably damaging Het
Olfr1451 G T 19: 12,998,998 C4F probably benign Het
Olfr549 A G 7: 102,554,721 I146V probably benign Het
Olfr799 A G 10: 129,647,179 D17G possibly damaging Het
Oprl1 A G 2: 181,715,754 E11G probably damaging Het
Palmd T A 3: 116,924,215 D211V probably damaging Het
Pcdhga11 A G 18: 37,756,325 N129D probably damaging Het
Plekha6 T A 1: 133,274,878 M359K probably damaging Het
Plekha7 G T 7: 116,143,320 H756Q probably benign Het
Ppfibp2 C T 7: 107,727,731 P441S probably benign Het
Ptprk T C 10: 28,591,982 I1373T possibly damaging Het
Serpinb9g G T 13: 33,492,917 L227F probably damaging Het
Snapc4 C A 2: 26,373,599 A11S probably benign Het
Sqor T C 2: 122,784,980 V7A probably benign Het
Sqor G T 2: 122,809,295 G437V probably damaging Het
Srrm3 T C 5: 135,852,281 V145A probably benign Het
Stx1b G A 7: 127,814,979 Q72* probably null Het
Syt7 A G 19: 10,421,771 D77G probably damaging Het
Tvp23a G A 16: 10,447,020 A9V probably benign Het
Vmn1r66 T A 7: 10,274,765 I114F probably damaging Het
Vmn2r80 C A 10: 79,169,668 Q380K probably benign Het
Xdh C T 17: 73,923,130 E269K probably damaging Het
Zfp932 T C 5: 110,008,715 M92T probably benign Het
Other mutations in Igkv4-90
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03154:Igkv4-90 APN 6 68807272 missense probably damaging 0.97
R3729:Igkv4-90 UTSW 6 68807681 missense probably benign 0.43
R4259:Igkv4-90 UTSW 6 68807477 missense possibly damaging 0.60
R5873:Igkv4-90 UTSW 6 68807469 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GGTGAGCAAAATTTCTCCATTGG -3'
(R):5'- CCGGTTTGCCTTAGTTAACAGAC -3'

Sequencing Primer
(F):5'- GCAAAATTTCTCCATTGGTCAATATG -3'
(R):5'- ACAGACCATGTATTTAAAAGCCAAG -3'
Posted On2018-09-12