Incidental Mutation 'R6843:Olfr1306'
ID534603
Institutional Source Beutler Lab
Gene Symbol Olfr1306
Ensembl Gene ENSMUSG00000096566
Gene Nameolfactory receptor 1306
SynonymsGA_x6K02T2Q125-72954873-72953935, MOR245-15
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.091) question?
Stock #R6843 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location111911264-111916271 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 111912915 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 5 (N5S)
Ref Sequence ENSEMBL: ENSMUSP00000151142 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099607] [ENSMUST00000214844]
Predicted Effect probably damaging
Transcript: ENSMUST00000099607
AA Change: N5S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000097202
Gene: ENSMUSG00000096566
AA Change: N5S

DomainStartEndE-ValueType
Pfam:7tm_4 30 305 4.7e-43 PFAM
Pfam:7tm_1 41 287 9.7e-25 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000214844
AA Change: N5S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.8%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m A T 6: 121,638,401 Q78L probably benign Het
Akr1c21 A G 13: 4,575,214 H48R probably damaging Het
Anks1b T A 10: 90,948,598 S1143T probably damaging Het
Apip T G 2: 103,092,489 F217L probably benign Het
Ash1l T A 3: 88,985,388 Y1525N probably damaging Het
Bcl2l13 G A 6: 120,848,617 probably null Het
Cep85 C G 4: 134,155,856 A241P probably benign Het
Clk4 T G 11: 51,276,249 probably null Het
Cnr2 C T 4: 135,917,589 P326L probably benign Het
Cryaa A G 17: 31,678,173 D58G possibly damaging Het
Crybg3 G A 16: 59,559,796 T365M probably benign Het
Csmd2 A G 4: 128,463,794 N1683D probably benign Het
Dbx2 T G 15: 95,654,459 I102L possibly damaging Het
Dll4 A T 2: 119,325,994 probably benign Het
Epb42 T A 2: 121,027,685 Y264F possibly damaging Het
Exoc3l T A 8: 105,290,097 H695L probably benign Het
Fam160a1 G A 3: 85,673,045 P618S probably damaging Het
Ghsr A C 3: 27,372,527 D244A probably benign Het
Gm9195 A G 14: 72,441,211 Y2268H possibly damaging Het
Hdac1 A G 4: 129,542,590 Y14H probably damaging Het
Hdac3 A T 18: 37,941,954 Y282N probably benign Het
Heg1 T A 16: 33,719,526 N285K probably benign Het
Igkv4-90 A G 6: 68,807,686 F8S possibly damaging Het
Map2k1 A T 9: 64,187,691 D336E probably damaging Het
Map4k2 A T 19: 6,353,447 I796F probably damaging Het
Mapk13 T A 17: 28,775,453 probably null Het
Mprip A G 11: 59,759,728 I1419M possibly damaging Het
Nrap T C 19: 56,380,219 E255G probably damaging Het
Olfr1357 T C 10: 78,612,057 N195D probably damaging Het
Olfr1451 G T 19: 12,998,998 C4F probably benign Het
Olfr549 A G 7: 102,554,721 I146V probably benign Het
Olfr799 A G 10: 129,647,179 D17G possibly damaging Het
Oprl1 A G 2: 181,715,754 E11G probably damaging Het
Palmd T A 3: 116,924,215 D211V probably damaging Het
Pcdhga11 A G 18: 37,756,325 N129D probably damaging Het
Plekha6 T A 1: 133,274,878 M359K probably damaging Het
Plekha7 G T 7: 116,143,320 H756Q probably benign Het
Ppfibp2 C T 7: 107,727,731 P441S probably benign Het
Ptprk T C 10: 28,591,982 I1373T possibly damaging Het
Serpinb9g G T 13: 33,492,917 L227F probably damaging Het
Snapc4 C A 2: 26,373,599 A11S probably benign Het
Sqor T C 2: 122,784,980 V7A probably benign Het
Sqor G T 2: 122,809,295 G437V probably damaging Het
Srrm3 T C 5: 135,852,281 V145A probably benign Het
Stx1b G A 7: 127,814,979 Q72* probably null Het
Syt7 A G 19: 10,421,771 D77G probably damaging Het
Tvp23a G A 16: 10,447,020 A9V probably benign Het
Vmn1r66 T A 7: 10,274,765 I114F probably damaging Het
Vmn2r80 C A 10: 79,169,668 Q380K probably benign Het
Xdh C T 17: 73,923,130 E269K probably damaging Het
Zfp932 T C 5: 110,008,715 M92T probably benign Het
Other mutations in Olfr1306
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00323:Olfr1306 APN 2 111912036 missense possibly damaging 0.95
IGL01310:Olfr1306 APN 2 111912307 missense probably benign 0.34
IGL01893:Olfr1306 APN 2 111912244 missense possibly damaging 0.65
IGL02433:Olfr1306 APN 2 111912417 missense probably damaging 1.00
IGL03302:Olfr1306 APN 2 111912822 missense possibly damaging 0.61
R0544:Olfr1306 UTSW 2 111912560 nonsense probably null
R0674:Olfr1306 UTSW 2 111912673 missense probably benign 0.41
R1118:Olfr1306 UTSW 2 111912877 missense probably benign 0.02
R1764:Olfr1306 UTSW 2 111912181 missense possibly damaging 0.93
R2915:Olfr1306 UTSW 2 111912719 missense probably damaging 1.00
R3976:Olfr1306 UTSW 2 111912606 missense possibly damaging 0.84
R4855:Olfr1306 UTSW 2 111912099 missense probably benign 0.41
R6475:Olfr1306 UTSW 2 111912859 nonsense probably null
R6513:Olfr1306 UTSW 2 111912883 missense possibly damaging 0.89
R6536:Olfr1306 UTSW 2 111912774 missense possibly damaging 0.94
R6748:Olfr1306 UTSW 2 111912357 missense possibly damaging 0.47
R7006:Olfr1306 UTSW 2 111912256 missense probably benign 0.16
R7169:Olfr1306 UTSW 2 111912594 missense possibly damaging 0.95
R7230:Olfr1306 UTSW 2 111912561 missense probably damaging 1.00
R7419:Olfr1306 UTSW 2 111912090 missense probably damaging 1.00
R7448:Olfr1306 UTSW 2 111912292 missense probably benign 0.00
R7753:Olfr1306 UTSW 2 111912582 missense probably benign 0.06
R7761:Olfr1306 UTSW 2 111912877 missense probably benign 0.02
R8330:Olfr1306 UTSW 2 111912379 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CCTGTAAAGGAGATGACTTTGTG -3'
(R):5'- GGATACTCTCCTTTAAAATCCAACC -3'

Sequencing Primer
(F):5'- AAAGGAGATGACTTTGTGCTTTC -3'
(R):5'- CATTCACCTTCACTTGTTATTTATGG -3'
Posted On2018-09-12