Incidental Mutation 'R6843:Snapc4'
ID534601
Institutional Source Beutler Lab
Gene Symbol Snapc4
Ensembl Gene ENSMUSG00000036281
Gene Namesmall nuclear RNA activating complex, polypeptide 4
Synonyms5730436L13Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6843 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location26362765-26380653 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 26373599 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Serine at position 11 (A11S)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035427] [ENSMUST00000114115]
Predicted Effect probably benign
Transcript: ENSMUST00000035427
SMART Domains Protein: ENSMUSP00000041767
Gene: ENSMUSG00000036281

DomainStartEndE-ValueType
low complexity region 33 52 N/A INTRINSIC
low complexity region 60 72 N/A INTRINSIC
coiled coil region 93 119 N/A INTRINSIC
low complexity region 200 212 N/A INTRINSIC
SANT 219 290 2.37e1 SMART
SANT 293 343 4.38e-10 SMART
SANT 345 397 3.05e-9 SMART
SANT 400 449 8.24e-15 SMART
SANT 452 501 7.8e-16 SMART
low complexity region 516 547 N/A INTRINSIC
Blast:SANT 550 753 1e-23 BLAST
low complexity region 893 909 N/A INTRINSIC
low complexity region 925 947 N/A INTRINSIC
low complexity region 971 983 N/A INTRINSIC
low complexity region 988 1007 N/A INTRINSIC
low complexity region 1157 1169 N/A INTRINSIC
low complexity region 1176 1190 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114115
SMART Domains Protein: ENSMUSP00000109750
Gene: ENSMUSG00000036281

DomainStartEndE-ValueType
coiled coil region 3 29 N/A INTRINSIC
low complexity region 41 60 N/A INTRINSIC
low complexity region 68 80 N/A INTRINSIC
coiled coil region 101 127 N/A INTRINSIC
low complexity region 208 220 N/A INTRINSIC
SANT 227 298 2.37e1 SMART
SANT 301 351 4.38e-10 SMART
SANT 353 405 3.05e-9 SMART
SANT 408 457 8.24e-15 SMART
SANT 460 509 7.8e-16 SMART
low complexity region 524 555 N/A INTRINSIC
Blast:SANT 558 761 1e-23 BLAST
low complexity region 901 917 N/A INTRINSIC
low complexity region 933 955 N/A INTRINSIC
low complexity region 979 991 N/A INTRINSIC
low complexity region 996 1015 N/A INTRINSIC
low complexity region 1165 1177 N/A INTRINSIC
low complexity region 1184 1198 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000123934
AA Change: A11S

PolyPhen 2 Score 0.033 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000122456
Gene: ENSMUSG00000036281
AA Change: A11S

DomainStartEndE-ValueType
SANT 47 99 3.05e-9 SMART
SANT 102 151 8.24e-15 SMART
SANT 154 203 7.8e-16 SMART
low complexity region 218 249 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the largest subunit of the small nuclear RNA-activating protein (SNAP) complex. The encoded protein contains a Myb DNA-binding domain, and is essential for RNA polymerase II and III polymerase transcription from small nuclear RNA promoters. A mutation in this gene is associated with ankylosing spondylitis. [provided by RefSeq, Jul 2016]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m A T 6: 121,638,401 Q78L probably benign Het
Akr1c21 A G 13: 4,575,214 H48R probably damaging Het
Anks1b T A 10: 90,948,598 S1143T probably damaging Het
Apip T G 2: 103,092,489 F217L probably benign Het
Ash1l T A 3: 88,985,388 Y1525N probably damaging Het
Bcl2l13 G A 6: 120,848,617 probably null Het
Cep85 C G 4: 134,155,856 A241P probably benign Het
Clk4 T G 11: 51,276,249 probably null Het
Cnr2 C T 4: 135,917,589 P326L probably benign Het
Cryaa A G 17: 31,678,173 D58G possibly damaging Het
Crybg3 G A 16: 59,559,796 T365M probably benign Het
Csmd2 A G 4: 128,463,794 N1683D probably benign Het
Dbx2 T G 15: 95,654,459 I102L possibly damaging Het
Dll4 A T 2: 119,325,994 probably benign Het
Epb42 T A 2: 121,027,685 Y264F possibly damaging Het
Exoc3l T A 8: 105,290,097 H695L probably benign Het
Fam160a1 G A 3: 85,673,045 P618S probably damaging Het
Ghsr A C 3: 27,372,527 D244A probably benign Het
Gm9195 A G 14: 72,441,211 Y2268H possibly damaging Het
Hdac1 A G 4: 129,542,590 Y14H probably damaging Het
Hdac3 A T 18: 37,941,954 Y282N probably benign Het
Heg1 T A 16: 33,719,526 N285K probably benign Het
Igkv4-90 A G 6: 68,807,686 F8S possibly damaging Het
Map2k1 A T 9: 64,187,691 D336E probably damaging Het
Map4k2 A T 19: 6,353,447 I796F probably damaging Het
Mapk13 T A 17: 28,775,453 probably null Het
Mprip A G 11: 59,759,728 I1419M possibly damaging Het
Nrap T C 19: 56,380,219 E255G probably damaging Het
Olfr1306 T C 2: 111,912,915 N5S probably damaging Het
Olfr1357 T C 10: 78,612,057 N195D probably damaging Het
Olfr1451 G T 19: 12,998,998 C4F probably benign Het
Olfr549 A G 7: 102,554,721 I146V probably benign Het
Olfr799 A G 10: 129,647,179 D17G possibly damaging Het
Oprl1 A G 2: 181,715,754 E11G probably damaging Het
Palmd T A 3: 116,924,215 D211V probably damaging Het
Pcdhga11 A G 18: 37,756,325 N129D probably damaging Het
Plekha6 T A 1: 133,274,878 M359K probably damaging Het
Plekha7 G T 7: 116,143,320 H756Q probably benign Het
Ppfibp2 C T 7: 107,727,731 P441S probably benign Het
Ptprk T C 10: 28,591,982 I1373T possibly damaging Het
Serpinb9g G T 13: 33,492,917 L227F probably damaging Het
Sqor T C 2: 122,784,980 V7A probably benign Het
Sqor G T 2: 122,809,295 G437V probably damaging Het
Srrm3 T C 5: 135,852,281 V145A probably benign Het
Stx1b G A 7: 127,814,979 Q72* probably null Het
Syt7 A G 19: 10,421,771 D77G probably damaging Het
Tvp23a G A 16: 10,447,020 A9V probably benign Het
Vmn1r66 T A 7: 10,274,765 I114F probably damaging Het
Vmn2r80 C A 10: 79,169,668 Q380K probably benign Het
Xdh C T 17: 73,923,130 E269K probably damaging Het
Zfp932 T C 5: 110,008,715 M92T probably benign Het
Other mutations in Snapc4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00162:Snapc4 APN 2 26369312 missense probably benign
IGL01730:Snapc4 APN 2 26363724 unclassified probably null
IGL01958:Snapc4 APN 2 26366440 unclassified probably benign
IGL02354:Snapc4 APN 2 26367307 unclassified probably benign
IGL02425:Snapc4 APN 2 26368200 missense probably damaging 1.00
IGL02812:Snapc4 APN 2 26369372 missense probably benign 0.03
IGL02951:Snapc4 APN 2 26370835 missense probably benign 0.33
R0011:Snapc4 UTSW 2 26364813 missense probably benign 0.03
R0409:Snapc4 UTSW 2 26367216 missense probably benign 0.37
R0932:Snapc4 UTSW 2 26374646 missense probably damaging 1.00
R1674:Snapc4 UTSW 2 26376197 missense probably benign
R1878:Snapc4 UTSW 2 26376153 critical splice donor site probably null
R3722:Snapc4 UTSW 2 26365428 missense probably benign
R3886:Snapc4 UTSW 2 26365498 nonsense probably null
R3887:Snapc4 UTSW 2 26365498 nonsense probably null
R3888:Snapc4 UTSW 2 26365498 nonsense probably null
R3889:Snapc4 UTSW 2 26365498 nonsense probably null
R4638:Snapc4 UTSW 2 26365302 missense probably damaging 1.00
R4663:Snapc4 UTSW 2 26374181 missense possibly damaging 0.77
R4879:Snapc4 UTSW 2 26365992 missense possibly damaging 0.93
R4922:Snapc4 UTSW 2 26369233 missense probably benign
R5385:Snapc4 UTSW 2 26374503 missense probably benign 0.44
R5525:Snapc4 UTSW 2 26369526 small deletion probably benign
R5762:Snapc4 UTSW 2 26378606 missense probably damaging 1.00
R5839:Snapc4 UTSW 2 26365534 missense probably benign 0.01
R6300:Snapc4 UTSW 2 26378551 missense probably benign 0.14
R6422:Snapc4 UTSW 2 26368303 missense probably benign 0.00
R7044:Snapc4 UTSW 2 26369953 missense probably damaging 1.00
R7341:Snapc4 UTSW 2 26369261 missense probably benign 0.01
R7727:Snapc4 UTSW 2 26373434 missense probably damaging 1.00
R7941:Snapc4 UTSW 2 26376718 missense probably damaging 0.98
R8277:Snapc4 UTSW 2 26365710 missense probably benign 0.05
R8311:Snapc4 UTSW 2 26378534 missense probably benign
R8323:Snapc4 UTSW 2 26364699 missense probably benign 0.15
X0010:Snapc4 UTSW 2 26369961 missense probably damaging 1.00
X0011:Snapc4 UTSW 2 26369961 missense probably damaging 1.00
X0014:Snapc4 UTSW 2 26369961 missense probably damaging 1.00
X0017:Snapc4 UTSW 2 26369961 missense probably damaging 1.00
X0021:Snapc4 UTSW 2 26369961 missense probably damaging 1.00
X0023:Snapc4 UTSW 2 26369961 missense probably damaging 1.00
X0028:Snapc4 UTSW 2 26369961 missense probably damaging 1.00
X0033:Snapc4 UTSW 2 26369961 missense probably damaging 1.00
X0064:Snapc4 UTSW 2 26369961 missense probably damaging 1.00
X0067:Snapc4 UTSW 2 26369961 missense probably damaging 1.00
Z1176:Snapc4 UTSW 2 26368222 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTGAGCATGTGGTCTTCCTC -3'
(R):5'- TACCTCAAACTCTTGGCACC -3'

Sequencing Primer
(F):5'- ACTCCTTGCGTTTCAGGG -3'
(R):5'- ACCTCTCCTGCTTTGGGATTGG -3'
Posted On2018-09-12