Incidental Mutation 'R6843:Exoc3l'
ID534627
Institutional Source Beutler Lab
Gene Symbol Exoc3l
Ensembl Gene ENSMUSG00000043251
Gene Nameexocyst complex component 3-like
SynonymsC730015A04Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.143) question?
Stock #R6843 (G1)
Quality Score225.009
Status Not validated
Chromosome8
Chromosomal Location105289924-105296101 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 105290097 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 695 (H695L)
Ref Sequence ENSEMBL: ENSMUSP00000053766 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000014981] [ENSMUST00000057855] [ENSMUST00000171788] [ENSMUST00000212219] [ENSMUST00000212777] [ENSMUST00000212922]
Predicted Effect probably benign
Transcript: ENSMUST00000014981
SMART Domains Protein: ENSMUSP00000014981
Gene: ENSMUSG00000014837

DomainStartEndE-ValueType
DUF1704 148 457 1.07e-139 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000057855
AA Change: H695L

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000053766
Gene: ENSMUSG00000043251
AA Change: H695L

DomainStartEndE-ValueType
Pfam:Sec6 189 722 5.4e-116 PFAM
low complexity region 723 739 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000171788
SMART Domains Protein: ENSMUSP00000128530
Gene: ENSMUSG00000014837

DomainStartEndE-ValueType
DUF1704 148 457 1.07e-139 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000212219
Predicted Effect probably benign
Transcript: ENSMUST00000212777
Predicted Effect probably benign
Transcript: ENSMUST00000212922
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m A T 6: 121,638,401 Q78L probably benign Het
Akr1c21 A G 13: 4,575,214 H48R probably damaging Het
Anks1b T A 10: 90,948,598 S1143T probably damaging Het
Apip T G 2: 103,092,489 F217L probably benign Het
Ash1l T A 3: 88,985,388 Y1525N probably damaging Het
Bcl2l13 G A 6: 120,848,617 probably null Het
Cep85 C G 4: 134,155,856 A241P probably benign Het
Clk4 T G 11: 51,276,249 probably null Het
Cnr2 C T 4: 135,917,589 P326L probably benign Het
Cryaa A G 17: 31,678,173 D58G possibly damaging Het
Crybg3 G A 16: 59,559,796 T365M probably benign Het
Csmd2 A G 4: 128,463,794 N1683D probably benign Het
Dbx2 T G 15: 95,654,459 I102L possibly damaging Het
Dll4 A T 2: 119,325,994 probably benign Het
Epb42 T A 2: 121,027,685 Y264F possibly damaging Het
Fam160a1 G A 3: 85,673,045 P618S probably damaging Het
Ghsr A C 3: 27,372,527 D244A probably benign Het
Gm9195 A G 14: 72,441,211 Y2268H possibly damaging Het
Hdac1 A G 4: 129,542,590 Y14H probably damaging Het
Hdac3 A T 18: 37,941,954 Y282N probably benign Het
Heg1 T A 16: 33,719,526 N285K probably benign Het
Igkv4-90 A G 6: 68,807,686 F8S possibly damaging Het
Map2k1 A T 9: 64,187,691 D336E probably damaging Het
Map4k2 A T 19: 6,353,447 I796F probably damaging Het
Mapk13 T A 17: 28,775,453 probably null Het
Mprip A G 11: 59,759,728 I1419M possibly damaging Het
Nrap T C 19: 56,380,219 E255G probably damaging Het
Olfr1306 T C 2: 111,912,915 N5S probably damaging Het
Olfr1357 T C 10: 78,612,057 N195D probably damaging Het
Olfr1451 G T 19: 12,998,998 C4F probably benign Het
Olfr549 A G 7: 102,554,721 I146V probably benign Het
Olfr799 A G 10: 129,647,179 D17G possibly damaging Het
Oprl1 A G 2: 181,715,754 E11G probably damaging Het
Palmd T A 3: 116,924,215 D211V probably damaging Het
Pcdhga11 A G 18: 37,756,325 N129D probably damaging Het
Plekha6 T A 1: 133,274,878 M359K probably damaging Het
Plekha7 G T 7: 116,143,320 H756Q probably benign Het
Ppfibp2 C T 7: 107,727,731 P441S probably benign Het
Ptprk T C 10: 28,591,982 I1373T possibly damaging Het
Serpinb9g G T 13: 33,492,917 L227F probably damaging Het
Snapc4 C A 2: 26,373,599 A11S probably benign Het
Sqor T C 2: 122,784,980 V7A probably benign Het
Sqor G T 2: 122,809,295 G437V probably damaging Het
Srrm3 T C 5: 135,852,281 V145A probably benign Het
Stx1b G A 7: 127,814,979 Q72* probably null Het
Syt7 A G 19: 10,421,771 D77G probably damaging Het
Tvp23a G A 16: 10,447,020 A9V probably benign Het
Vmn1r66 T A 7: 10,274,765 I114F probably damaging Het
Vmn2r80 C A 10: 79,169,668 Q380K probably benign Het
Xdh C T 17: 73,923,130 E269K probably damaging Het
Zfp932 T C 5: 110,008,715 M92T probably benign Het
Other mutations in Exoc3l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00949:Exoc3l APN 8 105290498 missense probably benign 0.25
IGL01731:Exoc3l APN 8 105292955 missense probably benign 0.16
IGL02364:Exoc3l APN 8 105290577 missense possibly damaging 0.71
IGL02413:Exoc3l APN 8 105292438 missense probably damaging 1.00
IGL02512:Exoc3l APN 8 105290483 missense probably damaging 1.00
IGL02810:Exoc3l APN 8 105295348 missense probably damaging 1.00
R0045:Exoc3l UTSW 8 105293685 missense probably damaging 1.00
R0045:Exoc3l UTSW 8 105293685 missense probably damaging 1.00
R0183:Exoc3l UTSW 8 105295300 missense probably damaging 1.00
R0302:Exoc3l UTSW 8 105293543 missense probably benign 0.01
R1660:Exoc3l UTSW 8 105293060 critical splice donor site probably null
R1699:Exoc3l UTSW 8 105295013 missense probably benign 0.34
R1826:Exoc3l UTSW 8 105293618 missense probably damaging 0.97
R2275:Exoc3l UTSW 8 105290447 critical splice donor site probably null
R3928:Exoc3l UTSW 8 105290917 unclassified probably benign
R3938:Exoc3l UTSW 8 105293405 missense probably damaging 1.00
R4261:Exoc3l UTSW 8 105290967 missense probably damaging 0.98
R4273:Exoc3l UTSW 8 105289961 makesense probably null
R5518:Exoc3l UTSW 8 105293163 missense probably benign 0.27
R6471:Exoc3l UTSW 8 105290534 missense probably damaging 1.00
R6511:Exoc3l UTSW 8 105293255 missense probably benign 0.00
R6631:Exoc3l UTSW 8 105295361 missense probably damaging 1.00
R6694:Exoc3l UTSW 8 105290490 missense probably benign 0.15
R7310:Exoc3l UTSW 8 105293708 missense probably damaging 1.00
R7387:Exoc3l UTSW 8 105294973 missense probably damaging 1.00
R7442:Exoc3l UTSW 8 105292926 missense probably damaging 1.00
R7764:Exoc3l UTSW 8 105290701 missense possibly damaging 0.62
R7845:Exoc3l UTSW 8 105290150 missense probably damaging 1.00
R7928:Exoc3l UTSW 8 105290150 missense probably damaging 1.00
Z1176:Exoc3l UTSW 8 105290794 missense possibly damaging 0.74
Predicted Primers PCR Primer
(F):5'- CAACACATAGATTCAGACGTGTCG -3'
(R):5'- TGAGGGAACTGCTCAACCTC -3'

Sequencing Primer
(F):5'- GTAGACGTGGCTTTATTACGCAAAC -3'
(R):5'- ACACTGCTTGGCCTCGAG -3'
Posted On2018-09-12