Incidental Mutation 'R6888:Olfr1162'
ID537024
Institutional Source Beutler Lab
Gene Symbol Olfr1162
Ensembl Gene ENSMUSG00000075139
Gene Nameolfactory receptor 1162
SynonymsMOR174-14, GA_x6K02T2Q125-49542541-49541597
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.059) question?
Stock #R6888 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location88045920-88051129 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 88050264 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Threonine at position 120 (M120T)
Ref Sequence ENSEMBL: ENSMUSP00000139068 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099837] [ENSMUST00000183862]
Predicted Effect probably damaging
Transcript: ENSMUST00000099837
AA Change: M120T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000097425
Gene: ENSMUSG00000075139
AA Change: M120T

DomainStartEndE-ValueType
Pfam:7tm_4 33 310 2.9e-46 PFAM
Pfam:7tm_1 43 292 1.5e-14 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000183862
AA Change: M120T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000139068
Gene: ENSMUSG00000075139
AA Change: M120T

DomainStartEndE-ValueType
Pfam:7tm_1 43 292 4.2e-27 PFAM
Pfam:7tm_4 141 285 3.1e-37 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.1%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110051M20Rik A G 2: 91,421,894 Y41H probably damaging Het
Actg1 T C 11: 120,347,315 Y190C probably damaging Het
Adgrv1 A G 13: 81,508,669 I2902T probably damaging Het
AI429214 G A 8: 36,993,833 G45D possibly damaging Het
Ambra1 A G 2: 91,769,027 D164G probably damaging Het
Ap3b1 A T 13: 94,408,791 Q184L probably benign Het
Arhgef17 T C 7: 100,930,820 D307G possibly damaging Het
AY761185 A T 8: 20,944,555 Y52* probably null Het
Bfsp1 A G 2: 143,826,719 S647P probably benign Het
C130073F10Rik A G 4: 101,890,256 V192A probably benign Het
Cacna1g T A 11: 94,459,207 D604V probably benign Het
Ccdc170 T C 10: 4,546,854 V458A possibly damaging Het
Ccdc187 G A 2: 26,289,734 R238W probably damaging Het
Cdh1 A G 8: 106,658,314 S380G probably benign Het
Cdk5rap3 T C 11: 96,916,192 H4R probably benign Het
Cftr G A 6: 18,313,730 probably null Het
Dnajc16 A G 4: 141,776,992 V219A probably benign Het
Drd3 A T 16: 43,817,139 I266F probably benign Het
Dut A G 2: 125,257,124 D177G probably benign Het
Esr1 A G 10: 4,857,076 I331V probably benign Het
Fam129c G T 8: 71,603,739 R361L probably benign Het
Gm11110 A G 17: 57,102,143 probably benign Het
Grm7 G T 6: 111,358,353 G575V possibly damaging Het
Heatr3 A G 8: 88,170,884 Y531C probably damaging Het
Igfn1 A G 1: 135,982,480 V122A probably benign Het
Igsf21 T C 4: 140,034,743 D208G probably benign Het
Kntc1 T C 5: 123,811,310 Y1915H probably damaging Het
Lamc1 A T 1: 153,262,492 D205E probably damaging Het
Limch1 C T 5: 67,021,926 T713I probably benign Het
Lrp1b A G 2: 41,471,126 I555T probably benign Het
Lrp2 A T 2: 69,524,141 F448I probably damaging Het
March6 T C 15: 31,459,233 K896E probably benign Het
Mpp6 T G 6: 50,180,277 probably null Het
Mroh4 T C 15: 74,613,249 Y469C possibly damaging Het
Nos3 T C 5: 24,383,335 V1060A possibly damaging Het
Nr1h4 A G 10: 89,456,542 I406T probably damaging Het
Odf2l T C 3: 145,148,618 probably null Het
Olfr1387 A T 11: 49,460,260 T194S probably damaging Het
Pbx2 A G 17: 34,594,107 Y119C possibly damaging Het
Pdcd6ip C A 9: 113,671,837 A526S probably benign Het
Prx G A 7: 27,519,634 D1187N possibly damaging Het
Ptpro G A 6: 137,380,200 V230I probably benign Het
Rtn3 C T 19: 7,457,249 M440I probably benign Het
Sar1b T C 11: 51,788,192 I96T probably damaging Het
Sds T C 5: 120,480,900 probably null Het
Secisbp2 A G 13: 51,679,941 T706A probably benign Het
Sorcs3 A T 19: 48,693,824 M433L possibly damaging Het
Sppl2a A G 2: 126,904,992 V472A probably damaging Het
Tbc1d9 A G 8: 83,271,588 E1258G possibly damaging Het
Tbxas1 C A 6: 38,952,074 probably benign Het
Tg T C 15: 66,696,246 I1333T probably damaging Het
Tmem108 C T 9: 103,499,716 G178D probably damaging Het
Tmem174 A G 13: 98,637,061 L87P probably damaging Het
Tmppe T A 9: 114,404,701 S23T probably damaging Het
Ttn G A 2: 76,761,103 T21074I probably benign Het
Tub A G 7: 109,029,298 M338V probably null Het
Vmn1r160 A T 7: 22,872,106 R295* probably null Het
Vps52 T C 17: 33,963,206 V518A probably benign Het
Wdr59 A G 8: 111,451,043 V909A probably benign Het
Wnk1 T C 6: 119,948,781 T1241A probably benign Het
Zfp882 G A 8: 71,914,286 C319Y probably benign Het
Znfx1 A T 2: 167,038,940 I308N possibly damaging Het
Other mutations in Olfr1162
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01669:Olfr1162 APN 2 88049784 missense possibly damaging 0.63
IGL01965:Olfr1162 APN 2 88050436 missense probably benign 0.14
IGL02183:Olfr1162 APN 2 88049989 missense possibly damaging 0.96
R0281:Olfr1162 UTSW 2 88050412 missense possibly damaging 0.96
R0501:Olfr1162 UTSW 2 88050471 missense probably damaging 1.00
R4254:Olfr1162 UTSW 2 88049779 missense possibly damaging 0.62
R4589:Olfr1162 UTSW 2 88050479 missense probably benign 0.12
R4824:Olfr1162 UTSW 2 88050088 missense probably damaging 1.00
R5148:Olfr1162 UTSW 2 88050393 missense probably benign 0.08
R5580:Olfr1162 UTSW 2 88050324 missense possibly damaging 0.79
R6174:Olfr1162 UTSW 2 88050302 nonsense probably null
Z1177:Olfr1162 UTSW 2 88050304 missense not run
Predicted Primers PCR Primer
(F):5'- TCACAGAAGAAGTGGTTGATCAC -3'
(R):5'- AACCTTGGGATGATAGCACTC -3'

Sequencing Primer
(F):5'- GAAGTGGTTGATCACATTAAATCTTG -3'
(R):5'- AAGTTCCACACTCCAATGTACTTC -3'
Posted On2018-10-18