Incidental Mutation 'R6888:Cdh1'
ID 537055
Institutional Source Beutler Lab
Gene Symbol Cdh1
Ensembl Gene ENSMUSG00000000303
Gene Name cadherin 1
Synonyms Ecad, UM, uvomorulin, E-cad, L-CAM, E-cadherin
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R6888 (G1)
Quality Score 225.009
Status Not validated
Chromosome 8
Chromosomal Location 106603351-106670246 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 106658314 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Glycine at position 380 (S380G)
Ref Sequence ENSEMBL: ENSMUSP00000132112 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000312] [ENSMUST00000167688]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000000312
AA Change: S380G

PolyPhen 2 Score 0.085 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000000312
Gene: ENSMUSG00000000303
AA Change: S380G

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Cadherin_pro 29 118 3.42e-36 SMART
low complexity region 123 131 N/A INTRINSIC
CA 179 262 2.27e-14 SMART
CA 286 375 3.18e-27 SMART
CA 398 487 2e-10 SMART
CA 510 595 1.49e-18 SMART
Pfam:Cadherin 600 688 5.3e-11 PFAM
transmembrane domain 711 733 N/A INTRINSIC
Pfam:Cadherin_C 734 881 1.3e-52 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000167688
AA Change: S380G

PolyPhen 2 Score 0.085 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000132112
Gene: ENSMUSG00000000303
AA Change: S380G

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Cadherin_pro 29 118 3.42e-36 SMART
low complexity region 123 131 N/A INTRINSIC
CA 179 262 2.27e-14 SMART
CA 286 375 3.18e-27 SMART
CA 398 487 2e-10 SMART
CA 510 595 1.49e-18 SMART
Pfam:Cadherin 600 688 7.1e-10 PFAM
transmembrane domain 711 733 N/A INTRINSIC
Pfam:Cadherin_C 738 880 3.9e-50 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.1%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes E-cadherin, a calcium-dependent cell adhesion molecule that functions in the establishment and maintenance of epithelial cell morphology during embryongenesis and adulthood. The encoded preproprotein undergoes proteolytic processing to generate a mature protein. Targeted mutations disrupting binding of calcium to the encoded protein in mice cause death in utero due to failed blastocyst and trophectoderm formation. This gene is located adjacent to a related cadherin gene on chromosome 8. [provided by RefSeq, Oct 2015]
PHENOTYPE: In mutant homozygotes, adhesive cells of the morula dissociate shortly after initial compaction, probably due to depletion of maternal protein. Mutant embryos fail to form a trophectodermal epithelium or blastocyst cavity, and die near implantation time. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110051M20Rik A G 2: 91,421,894 Y41H probably damaging Het
Actg1 T C 11: 120,347,315 Y190C probably damaging Het
Adgrv1 A G 13: 81,508,669 I2902T probably damaging Het
AI429214 G A 8: 36,993,833 G45D possibly damaging Het
Ambra1 A G 2: 91,769,027 D164G probably damaging Het
Ap3b1 A T 13: 94,408,791 Q184L probably benign Het
Arhgef17 T C 7: 100,930,820 D307G possibly damaging Het
AY761185 A T 8: 20,944,555 Y52* probably null Het
Bfsp1 A G 2: 143,826,719 S647P probably benign Het
C130073F10Rik A G 4: 101,890,256 V192A probably benign Het
Cacna1g T A 11: 94,459,207 D604V probably benign Het
Ccdc170 T C 10: 4,546,854 V458A possibly damaging Het
Ccdc187 G A 2: 26,289,734 R238W probably damaging Het
Cdk5rap3 T C 11: 96,916,192 H4R probably benign Het
Cftr G A 6: 18,313,730 probably null Het
Dnajc16 A G 4: 141,776,992 V219A probably benign Het
Drd3 A T 16: 43,817,139 I266F probably benign Het
Dut A G 2: 125,257,124 D177G probably benign Het
Esr1 A G 10: 4,857,076 I331V probably benign Het
Fam129c G T 8: 71,603,739 R361L probably benign Het
Gm11110 A G 17: 57,102,143 probably benign Het
Grm7 G T 6: 111,358,353 G575V possibly damaging Het
Heatr3 A G 8: 88,170,884 Y531C probably damaging Het
Igfn1 A G 1: 135,982,480 V122A probably benign Het
Igsf21 T C 4: 140,034,743 D208G probably benign Het
Kntc1 T C 5: 123,811,310 Y1915H probably damaging Het
Lamc1 A T 1: 153,262,492 D205E probably damaging Het
Limch1 C T 5: 67,021,926 T713I probably benign Het
Lrp1b A G 2: 41,471,126 I555T probably benign Het
Lrp2 A T 2: 69,524,141 F448I probably damaging Het
March6 T C 15: 31,459,233 K896E probably benign Het
Mpp6 T G 6: 50,180,277 probably null Het
Mroh4 T C 15: 74,613,249 Y469C possibly damaging Het
Nos3 T C 5: 24,383,335 V1060A possibly damaging Het
Nr1h4 A G 10: 89,456,542 I406T probably damaging Het
Odf2l T C 3: 145,148,618 probably null Het
Olfr1162 A G 2: 88,050,264 M120T probably damaging Het
Olfr1387 A T 11: 49,460,260 T194S probably damaging Het
Pbx2 A G 17: 34,594,107 Y119C possibly damaging Het
Pdcd6ip C A 9: 113,671,837 A526S probably benign Het
Prx G A 7: 27,519,634 D1187N possibly damaging Het
Ptpro G A 6: 137,380,200 V230I probably benign Het
Rtn3 C T 19: 7,457,249 M440I probably benign Het
Sar1b T C 11: 51,788,192 I96T probably damaging Het
Sds T C 5: 120,480,900 probably null Het
Secisbp2 A G 13: 51,679,941 T706A probably benign Het
Sorcs3 A T 19: 48,693,824 M433L possibly damaging Het
Sppl2a A G 2: 126,904,992 V472A probably damaging Het
Tbc1d9 A G 8: 83,271,588 E1258G possibly damaging Het
Tbxas1 C A 6: 38,952,074 probably benign Het
Tg T C 15: 66,696,246 I1333T probably damaging Het
Tmem108 C T 9: 103,499,716 G178D probably damaging Het
Tmem174 A G 13: 98,637,061 L87P probably damaging Het
Tmppe T A 9: 114,404,701 S23T probably damaging Het
Ttn G A 2: 76,761,103 T21074I probably benign Het
Tub A G 7: 109,029,298 M338V probably null Het
Vmn1r160 A T 7: 22,872,106 R295* probably null Het
Vps52 T C 17: 33,963,206 V518A probably benign Het
Wdr59 A G 8: 111,451,043 V909A probably benign Het
Wnk1 T C 6: 119,948,781 T1241A probably benign Het
Zfp882 G A 8: 71,914,286 C319Y probably benign Het
Znfx1 A T 2: 167,038,940 I308N possibly damaging Het
Other mutations in Cdh1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01147:Cdh1 APN 8 106660884 missense probably damaging 1.00
IGL01405:Cdh1 APN 8 106649001 missense probably damaging 0.97
IGL01410:Cdh1 APN 8 106657853 missense probably benign 0.19
IGL01901:Cdh1 APN 8 106657760 missense probably damaging 0.99
IGL02197:Cdh1 APN 8 106653786 missense probably benign 0.29
IGL02580:Cdh1 APN 8 106649018 missense probably benign 0.01
IGL02690:Cdh1 APN 8 106657884 missense probably damaging 1.00
IGL02732:Cdh1 APN 8 106666323 missense probably damaging 1.00
IGL02927:Cdh1 APN 8 106668511 missense probably damaging 1.00
R1777:Cdh1 UTSW 8 106656835 missense probably damaging 1.00
R1826:Cdh1 UTSW 8 106666266 missense probably benign 0.03
R1892:Cdh1 UTSW 8 106664250 missense possibly damaging 0.72
R2045:Cdh1 UTSW 8 106666182 splice site probably benign
R2100:Cdh1 UTSW 8 106659668 missense possibly damaging 0.57
R2104:Cdh1 UTSW 8 106653759 splice site probably benign
R2118:Cdh1 UTSW 8 106664210 missense probably benign
R2121:Cdh1 UTSW 8 106664210 missense probably benign
R2124:Cdh1 UTSW 8 106664210 missense probably benign
R2125:Cdh1 UTSW 8 106656840 missense probably damaging 0.99
R2163:Cdh1 UTSW 8 106649081 missense probably benign 0.01
R2165:Cdh1 UTSW 8 106664321 missense probably damaging 1.00
R2266:Cdh1 UTSW 8 106662003 missense probably benign
R2761:Cdh1 UTSW 8 106653849 missense possibly damaging 0.90
R4547:Cdh1 UTSW 8 106663903 missense probably damaging 1.00
R5131:Cdh1 UTSW 8 106663798 missense possibly damaging 0.95
R5767:Cdh1 UTSW 8 106668555 missense probably damaging 0.97
R5931:Cdh1 UTSW 8 106666332 critical splice donor site probably null
R6254:Cdh1 UTSW 8 106663798 missense probably damaging 1.00
R6397:Cdh1 UTSW 8 106604290 missense possibly damaging 0.81
R6928:Cdh1 UTSW 8 106661010 missense possibly damaging 0.93
R6995:Cdh1 UTSW 8 106660913 missense probably benign 0.02
R7110:Cdh1 UTSW 8 106668544 missense possibly damaging 0.87
R8069:Cdh1 UTSW 8 106657773 missense probably benign 0.26
R8260:Cdh1 UTSW 8 106604347 missense probably benign 0.01
R8387:Cdh1 UTSW 8 106663869 missense probably benign 0.02
R8762:Cdh1 UTSW 8 106659704 missense probably damaging 1.00
R8881:Cdh1 UTSW 8 106666272 missense probably benign 0.00
R8888:Cdh1 UTSW 8 106604339 missense probably damaging 1.00
R8928:Cdh1 UTSW 8 106666238 small deletion probably benign
R8929:Cdh1 UTSW 8 106666238 small deletion probably benign
R8930:Cdh1 UTSW 8 106666238 small deletion probably benign
R8932:Cdh1 UTSW 8 106666238 small deletion probably benign
R9211:Cdh1 UTSW 8 106664330 missense probably benign 0.01
R9472:Cdh1 UTSW 8 106653616 missense probably damaging 1.00
Z1177:Cdh1 UTSW 8 106656839 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGTTAAGCACGTGGTCAAATAC -3'
(R):5'- AGCATTTCAAAGATTGTAGCTGCTC -3'

Sequencing Primer
(F):5'- AGCACGTGGTCAAATACTTTTC -3'
(R):5'- CAAAGATTGTAGCTGCTCTAGGATG -3'
Posted On 2018-10-18