Incidental Mutation 'R7011:Zfy2'
ID545057
Institutional Source Beutler Lab
Gene Symbol Zfy2
Ensembl Gene ENSMUSG00000000103
Gene Namezinc finger protein 2, Y-linked
SynonymsZfy-2
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.058) question?
Stock #R7011 (G1)
Quality Score221.999
Status Not validated
ChromosomeY
Chromosomal Location2106015-2170409 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 2107127 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Aspartic acid at position 502 (E502D)
Ref Sequence ENSEMBL: ENSMUSP00000139591 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000115891] [ENSMUST00000187148]
Predicted Effect possibly damaging
Transcript: ENSMUST00000115891
AA Change: E502D

PolyPhen 2 Score 0.588 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000111557
Gene: ENSMUSG00000000103
AA Change: E502D

DomainStartEndE-ValueType
low complexity region 3 13 N/A INTRINSIC
Pfam:Zfx_Zfy_act 68 388 1.1e-115 PFAM
ZnF_C2H2 403 425 3.69e-4 SMART
ZnF_C2H2 434 456 1.26e-2 SMART
ZnF_C2H2 491 514 1.41e0 SMART
ZnF_C2H2 520 542 3.69e-4 SMART
ZnF_C2H2 548 571 3.63e-3 SMART
ZnF_C2H2 577 599 1.02e1 SMART
ZnF_C2H2 605 628 3.58e-2 SMART
ZnF_C2H2 634 656 2.95e-3 SMART
ZnF_C2H2 662 685 1.23e0 SMART
ZnF_C2H2 691 713 1.45e-2 SMART
ZnF_C2H2 719 742 1.2e-3 SMART
ZnF_C2H2 748 770 3.34e-2 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000187148
AA Change: E502D

PolyPhen 2 Score 0.588 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000139591
Gene: ENSMUSG00000000103
AA Change: E502D

DomainStartEndE-ValueType
low complexity region 3 13 N/A INTRINSIC
Pfam:Zfx_Zfy_act 67 388 2.6e-149 PFAM
ZnF_C2H2 403 425 3.69e-4 SMART
ZnF_C2H2 434 456 1.26e-2 SMART
ZnF_C2H2 491 514 1.41e0 SMART
ZnF_C2H2 520 542 3.69e-4 SMART
ZnF_C2H2 548 571 3.63e-3 SMART
ZnF_C2H2 577 599 1.02e1 SMART
ZnF_C2H2 605 628 3.58e-2 SMART
ZnF_C2H2 634 656 2.95e-3 SMART
ZnF_C2H2 662 685 1.23e0 SMART
ZnF_C2H2 691 713 1.45e-2 SMART
ZnF_C2H2 719 742 1.2e-3 SMART
ZnF_C2H2 748 770 3.34e-2 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 96% (66/69)
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam19 C T 11: 46,143,018 P886S probably benign Het
Anapc1 C T 2: 128,648,681 probably null Het
Ankrd34c C A 9: 89,728,948 G447* probably null Het
Apbb1ip A T 2: 22,835,931 E238D probably damaging Het
Arfgap1 T C 2: 180,972,142 L110P probably damaging Het
Arhgap21 G A 2: 20,848,878 T1901I possibly damaging Het
Brpf1 C A 6: 113,318,466 Q679K probably benign Het
Btnl2 A G 17: 34,363,513 E351G probably damaging Het
Cd209f T A 8: 4,104,859 T80S probably benign Het
Cdc16 A G 8: 13,769,451 E349G probably damaging Het
Cfap53 A T 18: 74,329,493 D436V probably benign Het
Crhr2 A T 6: 55,099,210 probably null Het
Cux1 T C 5: 136,360,033 K226E probably damaging Het
Ddr2 A T 1: 169,982,103 D768E probably damaging Het
Dhx8 T C 11: 101,741,520 L435P probably damaging Het
Dnah11 AGGCC AGGCCGGCC 12: 117,922,018 probably null Het
Eif4ebp1 G A 8: 27,273,344 R55Q probably damaging Het
Fbxo18 T A 2: 11,762,963 D358V probably damaging Het
Fra10ac1 T A 19: 38,188,794 E304D probably benign Het
Gabrb2 T C 11: 42,626,661 S399P possibly damaging Het
Gpatch2l G A 12: 86,244,184 R47H probably damaging Het
Gprin2 G T 14: 34,195,436 H126N probably null Het
Gucy1a1 A G 3: 82,109,115 S189P probably damaging Het
Htr1d T C 4: 136,443,006 M182T probably benign Het
Lipc A G 9: 70,818,954 F73L probably benign Het
Liph A G 16: 21,984,097 I74T probably damaging Het
Lrif1 T G 3: 106,732,285 Y229D probably damaging Het
Magel2 C T 7: 62,378,533 T395I possibly damaging Het
Magi3 T C 3: 104,105,754 N139S probably damaging Het
Man2c1 T A 9: 57,137,833 V336E probably damaging Het
Mapk12 A T 15: 89,135,600 Y135N probably damaging Het
Mapkapk3 C T 9: 107,289,396 probably benign Het
Mast1 A T 8: 84,911,945 Y653* probably null Het
Muc16 T A 9: 18,637,451 I5849F probably benign Het
Muc16 T A 9: 18,637,543 H5818L probably benign Het
Ndufa10 A G 1: 92,470,859 S68P probably damaging Het
Nedd1 C A 10: 92,690,773 L503F probably benign Het
Nr1i3 A G 1: 171,214,358 M4V probably benign Het
Olfr1121 G A 2: 87,372,260 A243T possibly damaging Het
Olfr1307 A T 2: 111,944,686 F257I probably benign Het
Olfr1501 T C 19: 13,839,039 I45V probably benign Het
Olfr332 T A 11: 58,490,144 I204F possibly damaging Het
Papd7 C T 13: 69,500,080 G489S probably damaging Het
Pcdh18 A T 3: 49,754,782 S695T probably benign Het
Pcdha1 T C 18: 36,930,535 I84T probably damaging Het
Plek T A 11: 16,994,760 D90V possibly damaging Het
Ppp6r1 A G 7: 4,646,826 C47R probably damaging Het
Psg27 G C 7: 18,556,873 N468K probably benign Het
Ptchd4 G A 17: 42,503,868 E887K probably benign Het
Rabgap1 C T 2: 37,540,480 L678F probably damaging Het
Rmdn3 T C 2: 119,138,423 Y429C probably damaging Het
Ros1 A T 10: 52,180,176 C73S probably damaging Het
Rtkn2 G A 10: 67,979,665 probably benign Het
Slc25a42 A G 8: 70,186,702 S242P probably damaging Het
Smtnl1 T A 2: 84,818,409 D167V probably benign Het
Smurf2 A G 11: 106,833,784 L511P probably benign Het
Stbd1 A T 5: 92,605,118 K156* probably null Het
Tenm4 G T 7: 96,896,135 G2453* probably null Het
Tpr A G 1: 150,433,772 K1760E probably damaging Het
Triobp T A 15: 78,978,723 L1427Q probably damaging Het
Uaca A G 9: 60,870,368 E679G probably damaging Het
Ucn3 T G 13: 3,941,421 H77P possibly damaging Het
Wnk2 T A 13: 49,071,091 D998V probably damaging Het
Xrcc3 A G 12: 111,804,535 V320A probably damaging Het
Zdbf2 A G 1: 63,306,766 T1435A possibly damaging Het
Zfp36l2 G T 17: 84,186,433 H259N possibly damaging Het
Zfp619 A T 7: 39,537,762 H1072L probably damaging Het
Zfyve16 G A 13: 92,521,987 P472L probably benign Het
Other mutations in Zfy2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02850:Zfy2 APN Y 2106894 missense probably benign 0.01
IGL02850:Zfy2 APN Y 2117188 missense probably benign 0.00
IGL02851:Zfy2 APN Y 2106894 missense probably benign 0.01
IGL02851:Zfy2 APN Y 2117188 missense probably benign 0.00
IGL02852:Zfy2 APN Y 2106894 missense probably benign 0.01
IGL02852:Zfy2 APN Y 2117188 missense probably benign 0.00
PIT4515001:Zfy2 UTSW Y 2117096 missense probably benign 0.09
R0426:Zfy2 UTSW Y 2107348 missense possibly damaging 0.61
R0490:Zfy2 UTSW Y 2106620 missense possibly damaging 0.89
R1080:Zfy2 UTSW Y 2121645 missense probably benign 0.00
R1513:Zfy2 UTSW Y 2116185 missense probably benign 0.00
R1935:Zfy2 UTSW Y 2121496 missense probably benign 0.02
R1936:Zfy2 UTSW Y 2121496 missense probably benign 0.02
R2358:Zfy2 UTSW Y 2107272 missense possibly damaging 0.61
R4484:Zfy2 UTSW Y 2107351 missense possibly damaging 0.86
R4754:Zfy2 UTSW Y 2121477 missense probably benign 0.02
R4777:Zfy2 UTSW Y 2116194 missense probably benign 0.00
R4812:Zfy2 UTSW Y 2106334 missense probably benign 0.08
R5045:Zfy2 UTSW Y 2107159 missense possibly damaging 0.77
R5363:Zfy2 UTSW Y 2106555 missense possibly damaging 0.95
R6256:Zfy2 UTSW Y 2116267 missense probably benign 0.02
R6618:Zfy2 UTSW Y 2121477 missense probably benign 0.10
R6941:Zfy2 UTSW Y 2121491 missense probably benign 0.02
R7712:Zfy2 UTSW Y 2121420 missense probably benign 0.05
R7759:Zfy2 UTSW Y 2117083 missense probably benign 0.02
R7985:Zfy2 UTSW Y 2116263 missense probably benign 0.00
R8051:Zfy2 UTSW Y 2117380 intron probably benign
R8218:Zfy2 UTSW Y 2133421 missense unknown
R8345:Zfy2 UTSW Y 2107096 missense possibly damaging 0.95
R8371:Zfy2 UTSW Y 2117168 missense probably benign 0.00
R8830:Zfy2 UTSW Y 2106600 missense possibly damaging 0.60
Predicted Primers PCR Primer
(F):5'- GGAGACAGATGCCACACTTCAG -3'
(R):5'- GAGTGTGATTACAGTACCAACAAG -3'

Sequencing Primer
(F):5'- TTTCAAGTTGGAAGAGTCTGCAGAC -3'
(R):5'- TTACAGTACCAACAAGAAGATAAGC -3'
Posted On2019-05-13