Incidental Mutation 'R7117:Kcnh5'
ID551874
Institutional Source Beutler Lab
Gene Symbol Kcnh5
Ensembl Gene ENSMUSG00000034402
Gene Namepotassium voltage-gated channel, subfamily H (eag-related), member 5
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7117 (G1)
Quality Score225.009
Status Validated
Chromosome12
Chromosomal Location74897220-75177332 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 75114445 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 230 (I230F)
Ref Sequence ENSEMBL: ENSMUSP00000046864 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042299]
Predicted Effect possibly damaging
Transcript: ENSMUST00000042299
AA Change: I230F

PolyPhen 2 Score 0.865 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000046864
Gene: ENSMUSG00000034402
AA Change: I230F

DomainStartEndE-ValueType
PAS 14 86 8.97e0 SMART
PAC 92 134 6.64e-7 SMART
Pfam:Ion_trans 214 479 1.2e-37 PFAM
Pfam:Ion_trans_2 390 473 5e-14 PFAM
cNMP 550 668 2.48e-15 SMART
low complexity region 710 717 N/A INTRINSIC
coiled coil region 907 944 N/A INTRINSIC
low complexity region 953 968 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 97% (95/98)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of voltage-gated potassium channels. Members of this family have diverse functions, including regulating neurotransmitter and hormone release, cardiac function, and cell volume. This protein is an outward-rectifying, noninactivating channel. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]
PHENOTYPE: Mice homozygous for a targeted gene disruption display thigmotaxis and abnormal startle reflex. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 98 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900026A02Rik T C 5: 113,191,384 Y254C probably benign Het
4930480E11Rik G T X: 78,370,705 M345I probably benign Het
9330182L06Rik T A 5: 9,445,384 C729* probably null Het
Adam12 T C 7: 133,916,462 I650V probably benign Het
Adam39 G T 8: 40,826,242 G557C probably damaging Het
Ak5 A G 3: 152,615,856 probably null Het
Arhgef10l C T 4: 140,564,186 probably null Het
Arhgef37 C T 18: 61,504,410 E394K probably benign Het
Baz2b A G 2: 59,912,497 V13A Het
Bnc1 G T 7: 81,973,361 A706E possibly damaging Het
Bscl2 G A 19: 8,848,514 A421T possibly damaging Het
Btn1a1 A C 13: 23,459,245 W345G possibly damaging Het
C3 A T 17: 57,212,655 M1199K probably benign Het
C87499 T A 4: 88,628,958 M246L probably damaging Het
Ccdc18 T G 5: 108,148,969 L213V possibly damaging Het
Cers2 T C 3: 95,320,761 probably null Het
Chpt1 T A 10: 88,480,849 H249L probably damaging Het
Cited2 A G 10: 17,724,616 E224G possibly damaging Het
Cntn5 T A 9: 10,904,699 probably benign Het
Col28a1 A G 6: 8,013,122 S977P possibly damaging Het
Col6a1 T C 10: 76,725,009 K52E probably damaging Het
Cpne2 T A 8: 94,555,544 H239Q probably damaging Het
Cr2 A T 1: 195,160,601 N244K possibly damaging Het
Csf2rb2 T C 15: 78,285,185 D590G probably damaging Het
Defb25 A C 2: 152,622,460 C55G probably damaging Het
Dnah7b A T 1: 46,352,813 probably null Het
Dvl3 T A 16: 20,527,322 Y467* probably null Het
Extl2 T C 3: 116,027,439 S312P probably damaging Het
Fam178b T C 1: 36,600,467 T313A probably benign Het
Fam186b A G 15: 99,285,590 Y58H probably damaging Het
Fat1 A T 8: 45,031,468 I3248L probably damaging Het
Fat2 A G 11: 55,281,262 F2875S probably damaging Het
Flnb T A 14: 7,894,214 N760K probably benign Het
Galnt14 T C 17: 73,494,195 H544R probably benign Het
Gpr137c A C 14: 45,279,027 R357S probably damaging Het
Grk2 A G 19: 4,290,602 probably null Het
Hectd2 A T 19: 36,599,655 T342S probably benign Het
Hfe2 G T 3: 96,528,226 V267L possibly damaging Het
Ildr2 G T 1: 166,295,811 G270C probably damaging Het
Insm2 C A 12: 55,600,572 A367D probably damaging Het
Keg1 T A 19: 12,709,678 S24T probably damaging Het
Kera A T 10: 97,612,852 E311D probably benign Het
Kit T A 5: 75,607,098 I47K probably benign Het
Megf6 A G 4: 154,258,922 T663A possibly damaging Het
Mettl21c G A 1: 44,010,648 A79V probably damaging Het
Mfsd1 T A 3: 67,600,058 probably null Het
Mob3b A G 4: 34,985,914 probably null Het
Morc2b T A 17: 33,137,952 H282L probably benign Het
Mtpap T C 18: 4,380,889 probably null Het
Mtus1 A G 8: 41,083,584 V365A possibly damaging Het
Muc5ac T A 7: 141,813,822 Y2993* probably null Het
Mycbp2 A C 14: 103,154,077 F3422V probably benign Het
Ndufb7 T A 8: 83,570,861 D48E probably benign Het
Nxpe5 A G 5: 138,239,442 Y88C probably damaging Het
Olfr1177-ps A G 2: 88,344,561 L64P probably damaging Het
Olfr575 T A 7: 102,954,978 M208L probably benign Het
Osbpl5 T A 7: 143,709,783 D121V probably benign Het
Oxnad1 A T 14: 32,091,651 H3L probably benign Het
Pam C A 1: 97,977,116 probably benign Het
Papolg T C 11: 23,895,207 probably benign Het
Pax1 G A 2: 147,366,270 G266D probably damaging Het
Pde11a A T 2: 76,076,004 M623K probably damaging Het
Peg3 GTGGGGCTCCTGGCCATGGGGCTTATCATCATGGGGCTCCTGGCCATGGGGCTTATCATCATGGGGCTCCTGGCCATGGGGCTTATCATCATGGGGCTC GTGGGGCTCCTGGCCATGGGGCTTATCATCATGGGGCTCCTGGCCATGGGGCTTATCATCATGGGGCTC 7: 6,709,168 probably benign Het
Phf21a A T 2: 92,359,157 Q587L probably benign Het
Plcb3 A G 19: 6,964,378 L336P probably damaging Het
Pnp2 T C 14: 50,964,474 *306Q probably null Het
Pou5f2 A G 13: 78,025,273 I111M probably benign Het
Prmt3 G T 7: 49,818,095 A350S probably benign Het
Rac3 A T 11: 120,723,517 R163* probably null Het
Raly G T 2: 154,857,512 V79L probably benign Het
Rbm20 A T 19: 53,851,558 T993S possibly damaging Het
Rwdd3 A G 3: 121,171,338 L56P probably benign Het
Serpina3a C T 12: 104,116,177 H70Y possibly damaging Het
Sez6l2 A C 7: 126,953,743 E227A possibly damaging Het
Shank1 C T 7: 44,327,161 A561V unknown Het
Sidt2 C T 9: 45,953,219 V71I probably benign Het
Slc35f6 T C 5: 30,657,707 L326P probably damaging Het
Sox2 G A 3: 34,650,926 G171S possibly damaging Het
Spef2 G A 15: 9,729,838 R65C probably damaging Het
Stip1 C T 19: 7,021,810 G467S possibly damaging Het
Tada2a T A 11: 84,085,688 I327F probably damaging Het
Tex2 A G 11: 106,544,245 V785A unknown Het
Thada C A 17: 84,230,786 probably null Het
Theg A T 10: 79,584,907 probably null Het
Tmed1 G A 9: 21,509,254 T94M possibly damaging Het
Tsr1 G T 11: 74,899,534 M149I probably benign Het
Ttc8 T C 12: 98,976,502 Y434H possibly damaging Het
Ttn A G 2: 76,748,175 Y24125H probably damaging Het
Ttn A G 2: 76,942,891 I2435T unknown Het
Ttn G T 2: 76,721,909 probably null Het
Uggt2 T C 14: 119,014,526 I1174M probably benign Het
Unc13b T C 4: 43,216,544 I281T probably benign Het
Usp1 G T 4: 98,928,890 K106N possibly damaging Het
Vwa3b A G 1: 37,135,553 D15G Het
Zfp28 G A 7: 6,394,462 C632Y probably damaging Het
Zfp68 T C 5: 138,606,318 D581G probably benign Het
Zmynd10 A C 9: 107,547,517 S21R probably benign Het
Zswim4 C T 8: 84,214,052 R806H probably damaging Het
Other mutations in Kcnh5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00470:Kcnh5 APN 12 74897796 missense probably benign 0.00
IGL00675:Kcnh5 APN 12 75114189 critical splice donor site probably null
IGL00688:Kcnh5 APN 12 74898397 missense probably benign 0.01
IGL00721:Kcnh5 APN 12 75007676 missense probably benign 0.32
IGL00793:Kcnh5 APN 12 75114346 missense probably damaging 0.99
IGL00802:Kcnh5 APN 12 75007625 missense possibly damaging 0.62
IGL00920:Kcnh5 APN 12 74976493 missense probably damaging 1.00
IGL01595:Kcnh5 APN 12 74898327 missense probably benign 0.05
IGL01642:Kcnh5 APN 12 74965169 missense probably damaging 0.98
IGL01675:Kcnh5 APN 12 75114500 nonsense probably null
IGL01733:Kcnh5 APN 12 74965192 missense probably benign 0.02
IGL02006:Kcnh5 APN 12 74897548 missense probably damaging 0.99
IGL02075:Kcnh5 APN 12 75087605 missense probably benign 0.00
IGL02148:Kcnh5 APN 12 74897652 missense possibly damaging 0.86
IGL02155:Kcnh5 APN 12 75176538 utr 5 prime probably benign
IGL02304:Kcnh5 APN 12 74976697 missense probably benign 0.01
IGL02957:Kcnh5 APN 12 75007665 missense probably benign 0.01
R0305:Kcnh5 UTSW 12 75114397 missense probably benign 0.00
R0470:Kcnh5 UTSW 12 75114414 missense probably benign 0.22
R0553:Kcnh5 UTSW 12 75137673 missense probably benign 0.00
R0557:Kcnh5 UTSW 12 75114549 missense probably damaging 1.00
R0590:Kcnh5 UTSW 12 74965261 missense probably damaging 1.00
R0697:Kcnh5 UTSW 12 74976531 missense possibly damaging 0.80
R0699:Kcnh5 UTSW 12 74976531 missense possibly damaging 0.80
R1512:Kcnh5 UTSW 12 75119937 missense probably benign
R1728:Kcnh5 UTSW 12 75137691 missense probably benign 0.18
R1739:Kcnh5 UTSW 12 75114229 missense probably damaging 1.00
R1784:Kcnh5 UTSW 12 75137691 missense probably benign 0.18
R1956:Kcnh5 UTSW 12 74897584 missense probably benign 0.01
R1957:Kcnh5 UTSW 12 74897584 missense probably benign 0.01
R2155:Kcnh5 UTSW 12 74898456 critical splice acceptor site probably null
R2185:Kcnh5 UTSW 12 75130931 missense possibly damaging 0.95
R2237:Kcnh5 UTSW 12 75007719 missense probably benign 0.00
R2239:Kcnh5 UTSW 12 75007719 missense probably benign 0.00
R2483:Kcnh5 UTSW 12 75114471 missense probably damaging 1.00
R2655:Kcnh5 UTSW 12 75114540 missense probably damaging 1.00
R3767:Kcnh5 UTSW 12 75087576 missense possibly damaging 0.81
R3835:Kcnh5 UTSW 12 74898270 missense probably benign
R4681:Kcnh5 UTSW 12 75007623 missense probably benign 0.00
R4728:Kcnh5 UTSW 12 75007781 missense probably damaging 1.00
R4965:Kcnh5 UTSW 12 74965151 missense probably benign 0.11
R5127:Kcnh5 UTSW 12 74898084 missense probably benign 0.17
R5267:Kcnh5 UTSW 12 75087416 missense probably damaging 0.98
R5535:Kcnh5 UTSW 12 75130907 missense possibly damaging 0.76
R5590:Kcnh5 UTSW 12 74976689 missense probably benign 0.05
R5684:Kcnh5 UTSW 12 75137649 missense probably damaging 1.00
R5747:Kcnh5 UTSW 12 74898420 missense probably benign 0.04
R6123:Kcnh5 UTSW 12 75087591 missense probably benign 0.01
R6545:Kcnh5 UTSW 12 75007658 missense probably damaging 1.00
R6662:Kcnh5 UTSW 12 75007611 missense probably damaging 1.00
R7161:Kcnh5 UTSW 12 74897709 missense probably benign 0.10
R7437:Kcnh5 UTSW 12 75137643 critical splice donor site probably null
R7557:Kcnh5 UTSW 12 75007625 missense possibly damaging 0.62
R7566:Kcnh5 UTSW 12 75114392 nonsense probably null
R7591:Kcnh5 UTSW 12 75007767 missense probably benign 0.24
R7781:Kcnh5 UTSW 12 74976681 missense probably damaging 0.99
R7816:Kcnh5 UTSW 12 74976683 missense probably damaging 1.00
R8152:Kcnh5 UTSW 12 74897859 missense possibly damaging 0.68
Z1088:Kcnh5 UTSW 12 74897761 missense probably benign 0.00
Z1088:Kcnh5 UTSW 12 74965295 missense possibly damaging 0.78
Z1177:Kcnh5 UTSW 12 75007797 missense possibly damaging 0.90
Z1177:Kcnh5 UTSW 12 75114522 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCATCCTTATAAGCTTCGGGTCAG -3'
(R):5'- AATCATGTGACTCGGTCTGTG -3'

Sequencing Primer
(F):5'- CCTTATAAGCTTCGGGTCAGAAATG -3'
(R):5'- TGCAGTCACAGCTGTCTTCAGAG -3'
Posted On2019-05-15