Incidental Mutation 'R7117:Bnc1'
ID551847
Institutional Source Beutler Lab
Gene Symbol Bnc1
Ensembl Gene ENSMUSG00000025105
Gene Namebasonuclin 1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7117 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location81966672-81992292 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 81973361 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Glutamic Acid at position 706 (A706E)
Ref Sequence ENSEMBL: ENSMUSP00000026096 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026096]
Predicted Effect possibly damaging
Transcript: ENSMUST00000026096
AA Change: A706E

PolyPhen 2 Score 0.919 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000026096
Gene: ENSMUSG00000025105
AA Change: A706E

DomainStartEndE-ValueType
low complexity region 2 25 N/A INTRINSIC
low complexity region 313 327 N/A INTRINSIC
ZnF_C2H2 354 377 1.43e-1 SMART
ZnF_C2H2 382 411 6.75e0 SMART
low complexity region 505 514 N/A INTRINSIC
low complexity region 541 554 N/A INTRINSIC
low complexity region 570 583 N/A INTRINSIC
low complexity region 619 633 N/A INTRINSIC
ZnF_C2H2 716 739 1.47e-3 SMART
ZnF_C2H2 744 771 5.62e0 SMART
low complexity region 855 876 N/A INTRINSIC
ZnF_C2H2 924 947 3.11e-2 SMART
ZnF_C2H2 952 979 8.09e-1 SMART
Meta Mutation Damage Score 0.1745 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 97% (95/98)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a zinc finger protein present in the basal cell layer of the epidermis and in hair follicles. It is also found in abundance in the germ cells of testis and ovary. This protein is thought to play a regulatory role in keratinocyte proliferation and it may also be a regulator for rRNA transcription. Alternative splicing of this gene results in multiple transcript variants, and multiple polyadenylation sites are indicated.[provided by RefSeq, Jul 2014]
PHENOTYPE: Mice homozygous for a null allele exhibit thinning and delayed wound healing of the corneal epithelium. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 98 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900026A02Rik T C 5: 113,191,384 Y254C probably benign Het
4930480E11Rik G T X: 78,370,705 M345I probably benign Het
9330182L06Rik T A 5: 9,445,384 C729* probably null Het
Adam12 T C 7: 133,916,462 I650V probably benign Het
Adam39 G T 8: 40,826,242 G557C probably damaging Het
Ak5 A G 3: 152,615,856 probably null Het
Arhgef10l C T 4: 140,564,186 probably null Het
Arhgef37 C T 18: 61,504,410 E394K probably benign Het
Baz2b A G 2: 59,912,497 V13A Het
Bscl2 G A 19: 8,848,514 A421T possibly damaging Het
Btn1a1 A C 13: 23,459,245 W345G possibly damaging Het
C3 A T 17: 57,212,655 M1199K probably benign Het
C87499 T A 4: 88,628,958 M246L probably damaging Het
Ccdc18 T G 5: 108,148,969 L213V possibly damaging Het
Cers2 T C 3: 95,320,761 probably null Het
Chpt1 T A 10: 88,480,849 H249L probably damaging Het
Cited2 A G 10: 17,724,616 E224G possibly damaging Het
Cntn5 T A 9: 10,904,699 probably benign Het
Col28a1 A G 6: 8,013,122 S977P possibly damaging Het
Col6a1 T C 10: 76,725,009 K52E probably damaging Het
Cpne2 T A 8: 94,555,544 H239Q probably damaging Het
Cr2 A T 1: 195,160,601 N244K possibly damaging Het
Csf2rb2 T C 15: 78,285,185 D590G probably damaging Het
Defb25 A C 2: 152,622,460 C55G probably damaging Het
Dnah7b A T 1: 46,352,813 probably null Het
Dvl3 T A 16: 20,527,322 Y467* probably null Het
Extl2 T C 3: 116,027,439 S312P probably damaging Het
Fam178b T C 1: 36,600,467 T313A probably benign Het
Fam186b A G 15: 99,285,590 Y58H probably damaging Het
Fat1 A T 8: 45,031,468 I3248L probably damaging Het
Fat2 A G 11: 55,281,262 F2875S probably damaging Het
Flnb T A 14: 7,894,214 N760K probably benign Het
Galnt14 T C 17: 73,494,195 H544R probably benign Het
Gpr137c A C 14: 45,279,027 R357S probably damaging Het
Grk2 A G 19: 4,290,602 probably null Het
Hectd2 A T 19: 36,599,655 T342S probably benign Het
Hfe2 G T 3: 96,528,226 V267L possibly damaging Het
Ildr2 G T 1: 166,295,811 G270C probably damaging Het
Insm2 C A 12: 55,600,572 A367D probably damaging Het
Kcnh5 T A 12: 75,114,445 I230F possibly damaging Het
Keg1 T A 19: 12,709,678 S24T probably damaging Het
Kera A T 10: 97,612,852 E311D probably benign Het
Kit T A 5: 75,607,098 I47K probably benign Het
Megf6 A G 4: 154,258,922 T663A possibly damaging Het
Mettl21c G A 1: 44,010,648 A79V probably damaging Het
Mfsd1 T A 3: 67,600,058 probably null Het
Mob3b A G 4: 34,985,914 probably null Het
Morc2b T A 17: 33,137,952 H282L probably benign Het
Mtpap T C 18: 4,380,889 probably null Het
Mtus1 A G 8: 41,083,584 V365A possibly damaging Het
Muc5ac T A 7: 141,813,822 Y2993* probably null Het
Mycbp2 A C 14: 103,154,077 F3422V probably benign Het
Ndufb7 T A 8: 83,570,861 D48E probably benign Het
Nxpe5 A G 5: 138,239,442 Y88C probably damaging Het
Olfr1177-ps A G 2: 88,344,561 L64P probably damaging Het
Olfr575 T A 7: 102,954,978 M208L probably benign Het
Osbpl5 T A 7: 143,709,783 D121V probably benign Het
Oxnad1 A T 14: 32,091,651 H3L probably benign Het
Pam C A 1: 97,977,116 probably benign Het
Papolg T C 11: 23,895,207 probably benign Het
Pax1 G A 2: 147,366,270 G266D probably damaging Het
Pde11a A T 2: 76,076,004 M623K probably damaging Het
Peg3 GTGGGGCTCCTGGCCATGGGGCTTATCATCATGGGGCTCCTGGCCATGGGGCTTATCATCATGGGGCTCCTGGCCATGGGGCTTATCATCATGGGGCTC GTGGGGCTCCTGGCCATGGGGCTTATCATCATGGGGCTCCTGGCCATGGGGCTTATCATCATGGGGCTC 7: 6,709,168 probably benign Het
Phf21a A T 2: 92,359,157 Q587L probably benign Het
Plcb3 A G 19: 6,964,378 L336P probably damaging Het
Pnp2 T C 14: 50,964,474 *306Q probably null Het
Pou5f2 A G 13: 78,025,273 I111M probably benign Het
Prmt3 G T 7: 49,818,095 A350S probably benign Het
Rac3 A T 11: 120,723,517 R163* probably null Het
Raly G T 2: 154,857,512 V79L probably benign Het
Rbm20 A T 19: 53,851,558 T993S possibly damaging Het
Rwdd3 A G 3: 121,171,338 L56P probably benign Het
Serpina3a C T 12: 104,116,177 H70Y possibly damaging Het
Sez6l2 A C 7: 126,953,743 E227A possibly damaging Het
Shank1 C T 7: 44,327,161 A561V unknown Het
Sidt2 C T 9: 45,953,219 V71I probably benign Het
Slc35f6 T C 5: 30,657,707 L326P probably damaging Het
Sox2 G A 3: 34,650,926 G171S possibly damaging Het
Spef2 G A 15: 9,729,838 R65C probably damaging Het
Stip1 C T 19: 7,021,810 G467S possibly damaging Het
Tada2a T A 11: 84,085,688 I327F probably damaging Het
Tex2 A G 11: 106,544,245 V785A unknown Het
Thada C A 17: 84,230,786 probably null Het
Theg A T 10: 79,584,907 probably null Het
Tmed1 G A 9: 21,509,254 T94M possibly damaging Het
Tsr1 G T 11: 74,899,534 M149I probably benign Het
Ttc8 T C 12: 98,976,502 Y434H possibly damaging Het
Ttn A G 2: 76,748,175 Y24125H probably damaging Het
Ttn A G 2: 76,942,891 I2435T unknown Het
Ttn G T 2: 76,721,909 probably null Het
Uggt2 T C 14: 119,014,526 I1174M probably benign Het
Unc13b T C 4: 43,216,544 I281T probably benign Het
Usp1 G T 4: 98,928,890 K106N possibly damaging Het
Vwa3b A G 1: 37,135,553 D15G Het
Zfp28 G A 7: 6,394,462 C632Y probably damaging Het
Zfp68 T C 5: 138,606,318 D581G probably benign Het
Zmynd10 A C 9: 107,547,517 S21R probably benign Het
Zswim4 C T 8: 84,214,052 R806H probably damaging Het
Other mutations in Bnc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01123:Bnc1 APN 7 81973707 nonsense probably null
IGL01293:Bnc1 APN 7 81974489 missense probably damaging 0.99
IGL02064:Bnc1 APN 7 81973503 missense probably benign 0.00
IGL02529:Bnc1 APN 7 81977368 missense probably damaging 0.99
IGL03087:Bnc1 APN 7 81974642 missense possibly damaging 0.86
R0088:Bnc1 UTSW 7 81978498 missense possibly damaging 0.52
R0312:Bnc1 UTSW 7 81977324 missense possibly damaging 0.95
R0631:Bnc1 UTSW 7 81974366 missense probably damaging 0.99
R0924:Bnc1 UTSW 7 81978408 splice site probably benign
R0928:Bnc1 UTSW 7 81973502 missense probably benign
R1967:Bnc1 UTSW 7 81973636 missense probably benign 0.03
R2243:Bnc1 UTSW 7 81974073 missense possibly damaging 0.59
R2404:Bnc1 UTSW 7 81968715 missense probably benign 0.08
R4079:Bnc1 UTSW 7 81973760 missense probably damaging 0.99
R4416:Bnc1 UTSW 7 81968960 missense probably benign
R5038:Bnc1 UTSW 7 81968714 missense probably damaging 1.00
R5055:Bnc1 UTSW 7 81974415 missense probably damaging 0.99
R7083:Bnc1 UTSW 7 81973310 missense probably damaging 1.00
R7151:Bnc1 UTSW 7 81973307 missense possibly damaging 0.71
R7386:Bnc1 UTSW 7 81974492 missense possibly damaging 0.81
Predicted Primers PCR Primer
(F):5'- GTCTCTGCTCCTACGGGAAG -3'
(R):5'- AGACCACGCTCACTGAGAGG -3'

Sequencing Primer
(F):5'- CTGCTCCTACGGGAAGGGAAAG -3'
(R):5'- CTGAGTTCAGTGATGCCAAGAG -3'
Posted On2019-05-15