Mutagenetix > Incidental Mutations

Incidental Mutation 'R7128:Srf'

552489

Institutional Source

Beutler Lab

Gene Symbol

Srf

Ensembl Gene

ENSMUSG00000015605

Gene Name

serum response factor

Synonyms

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R7128 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

46546839-46556162 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 46555446 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Asparagine at position 128 (S128N)

Ref Sequence

ENSEMBL: ENSMUSP00000015749 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000015749]

AlphaFold

Q9JM73

Predicted Effect

possibly damaging
Transcript: ENSMUST00000015749
AA Change: S128N

PolyPhen 2 Score 0.883 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000015749
Gene: ENSMUSG00000015605
AA Change: S128N

Domain	Start	End	E-Value	Type
low complexity region	6	46	N/A	INTRINSIC
low complexity region	60	70	N/A	INTRINSIC
low complexity region	73	90	N/A	INTRINSIC
low complexity region	104	130	N/A	INTRINSIC
MADS	137	196	3.08e-28	SMART
low complexity region	217	229	N/A	INTRINSIC
Blast:MADS	256	289	3e-11	BLAST
low complexity region	300	314	N/A	INTRINSIC
internal_repeat_1	335	360	6.39e-6	PROSPERO
low complexity region	368	383	N/A	INTRINSIC
internal_repeat_1	450	473	6.39e-6	PROSPERO

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a ubiquitous nuclear protein that stimulates both cell proliferation and differentiation. It is a member of the MADS (MCM1, Agamous, Deficiens, and SRF) box superfamily of transcription factors. This protein binds to the serum response element (SRE) in the promoter region of target genes. This protein regulates the activity of many immediate-early genes, for example c-fos, and thereby participates in cell cycle regulation, apoptosis, cell growth, and cell differentiation. This gene is the downstream target of many pathways; for example, the mitogen-activated protein kinase pathway (MAPK) that acts through the ternary complex factors (TCFs). Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2014]
PHENOTYPE: Homozygous null mice exhibit embryonic lethality, abnormal gastrulation, no mesoderm or primitive streak formation and reduced embryo size. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 68 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9930021J03Rik	T	C	19: 29,716,481	T1871A	possibly damaging	Het
Adgb	T	C	10: 10,472,241	D25G	probably benign	Het
Ak9	T	C	10: 41,424,717	V1641A	unknown	Het
Akap2	T	C	4: 57,855,816	S382P	probably benign	Het
Akirin2	T	C	4: 34,562,435	I118T	probably benign	Het
Aldh1l1	G	T	6: 90,563,379	Q215H	probably benign	Het
Arhgef26	T	C	3: 62,419,550	F495L	possibly damaging	Het
Atg4a-ps	T	A	3: 103,645,747	R93*	probably null	Het
AW822073	T	C	10: 58,223,657	Q425R	unknown	Het
Catsper3	A	G	13: 55,798,849	I120V	probably benign	Het
Cavin2	A	G	1: 51,289,420	Q12R	possibly damaging	Het
Cenpf	A	T	1: 189,684,991	F39Y	probably damaging	Het
Chfr	T	C	5: 110,143,636	Y107H	probably benign	Het
Cmtm1	CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT	CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT	8: 104,309,470		probably benign	Het
Defb4	T	A	8: 19,201,204	I29K	possibly damaging	Het
Dnah7c	A	G	1: 46,527,485	T619A	probably benign	Het
Emc3	A	G	6: 113,517,920	L179P	probably damaging	Het
Eno3	G	C	11: 70,658,604	V84L	possibly damaging	Het
Fam110a	C	T	2: 151,970,722	V43M	probably damaging	Het
Fam159a	G	T	4: 108,367,903	T154K	probably benign	Het
Fbxo30	T	A	10: 11,290,116	L194*	probably null	Het
Galnt14	T	C	17: 73,545,101	T108A	probably benign	Het
Glipr2	T	C	4: 43,968,601	I51T	probably benign	Het
Gm1527	C	T	3: 28,915,311	S270F	possibly damaging	Het
Gm3336	A	G	8: 70,718,554	M1V	probably null	Het
Gm4744	T	C	6: 40,950,376	D15G		Het
Gm4763	C	T	7: 24,725,999		probably null	Het
Gm4924	G	A	10: 82,378,699	C777Y	unknown	Het
Gm5901	G	A	7: 105,378,201	G306S	probably damaging	Het
Gon4l	T	A	3: 88,895,692	N1203K	possibly damaging	Het
Gpr161	A	T	1: 165,310,457	Y204F	possibly damaging	Het
Igsf10	T	C	3: 59,328,905	E1285G	probably benign	Het
Irx6	T	C	8: 92,677,366	L187P	probably damaging	Het
Itgb1bp1	A	G	12: 21,272,088	Y117H	probably benign	Het
Itln1	C	A	1: 171,530,575	D202Y	possibly damaging	Het
Kctd9	T	C	14: 67,738,523	S242P	probably benign	Het
Lrrk2	A	G	15: 91,801,885	H2143R	probably benign	Het
Lynx1	G	A	15: 74,751,549	R50*	probably null	Het
Map10	A	G	8: 125,671,853	I662V	probably benign	Het
Mlxipl	T	C	5: 135,133,851	L691P	probably damaging	Het
Muc16	A	G	9: 18,643,004	S3998P	unknown	Het
Nalcn	A	T	14: 123,594,502	V120E	probably damaging	Het
Nfat5	T	C	8: 107,358,691	S539P	probably benign	Het
Olfml3	T	C	3: 103,737,168	M62V	probably benign	Het
Orm3	T	C	4: 63,357,825	V158A	probably benign	Het
Pced1b	A	T	15: 97,384,598	K173*	probably null	Het
Pdzd7	T	C	19: 45,027,949	D911G	probably damaging	Het
Pkn3	A	G	2: 30,083,315	D383G	probably damaging	Het
Pm20d1	A	G	1: 131,797,554	E46G	probably benign	Het
Pyroxd2	A	T	19: 42,731,403	S455T	probably benign	Het
Rmnd5b	T	A	11: 51,624,537	I301F	possibly damaging	Het
Rnf225	A	G	7: 12,927,984	N30S	probably benign	Het
Slfn3	T	A	11: 83,214,895	C573S	probably benign	Het
Smc6	A	G	12: 11,301,631	E887G	probably damaging	Het
Sp140	A	T	1: 85,620,125	D191V	possibly damaging	Het
Sult6b1	T	C	17: 78,894,641	D144G	probably damaging	Het
Syne1	G	A	10: 5,243,180	A3956V	probably damaging	Het
Syt10	A	T	15: 89,814,111	D343E	probably damaging	Het
Tgtp2	G	A	11: 49,059,308	R146C	possibly damaging	Het
Tmcc3	A	T	10: 94,430,634		probably benign	Het
Tnfrsf1a	A	T	6: 125,361,536	T337S	probably benign	Het
Tns1	A	T	1: 73,995,304	I144N		Het
Trim11	A	G	11: 58,978,277	E13G	probably damaging	Het
Trpm6	A	T	19: 18,811,773	H569L	possibly damaging	Het
Ttbk2	T	A	2: 120,746,088	I803L	probably benign	Het
Vmn1r21	G	T	6: 57,843,951	N169K	probably damaging	Het
Vmn2r60	C	T	7: 42,195,112	T633I	probably damaging	Het
Wt1	T	C	2: 105,127,325	Y177H	probably benign	Het

Other mutations in Srf

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01836:Srf	APN	17	46549182	unclassified	probably benign
IGL02448:Srf	APN	17	46555423	missense	possibly damaging	0.47
R0277:Srf	UTSW	17	46549489	missense	possibly damaging	0.54
R0323:Srf	UTSW	17	46549489	missense	possibly damaging	0.54
R1633:Srf	UTSW	17	46551608	missense	probably damaging	1.00
R1807:Srf	UTSW	17	46553759	missense	possibly damaging	0.88
R1930:Srf	UTSW	17	46549986	missense	probably damaging	1.00
R1932:Srf	UTSW	17	46549986	missense	probably damaging	1.00
R1951:Srf	UTSW	17	46551707	missense	possibly damaging	0.94
R4851:Srf	UTSW	17	46549474	missense	probably benign	0.33
R7017:Srf	UTSW	17	46550904	missense	probably benign	0.18
R7177:Srf	UTSW	17	46555392	missense	probably damaging	0.99
R7315:Srf	UTSW	17	46551794	critical splice acceptor site	probably null
R8019:Srf	UTSW	17	46555822	missense	unknown
R8678:Srf	UTSW	17	46550899	critical splice donor site	probably null
R8927:Srf	UTSW	17	46549169	missense	probably damaging	1.00
R8928:Srf	UTSW	17	46549169	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ACACACCTCCTGCGGACTAG -3'
(R):5'- GCCATGTTACCGAGCCAAG -3'

Sequencing Primer
(F):5'- GCTACCTTAGAGCGCACC -3'
(R):5'- AGAGTCGTCTGGAGCGG -3'

Posted On

2019-05-15