Incidental Mutation 'R7128:Srf'
ID 552489
Institutional Source Beutler Lab
Gene Symbol Srf
Ensembl Gene ENSMUSG00000015605
Gene Name serum response factor
Synonyms
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R7128 (G1)
Quality Score 225.009
Status Not validated
Chromosome 17
Chromosomal Location 46546839-46556162 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 46555446 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Asparagine at position 128 (S128N)
Ref Sequence ENSEMBL: ENSMUSP00000015749 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000015749]
AlphaFold Q9JM73
Predicted Effect possibly damaging
Transcript: ENSMUST00000015749
AA Change: S128N

PolyPhen 2 Score 0.883 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000015749
Gene: ENSMUSG00000015605
AA Change: S128N

DomainStartEndE-ValueType
low complexity region 6 46 N/A INTRINSIC
low complexity region 60 70 N/A INTRINSIC
low complexity region 73 90 N/A INTRINSIC
low complexity region 104 130 N/A INTRINSIC
MADS 137 196 3.08e-28 SMART
low complexity region 217 229 N/A INTRINSIC
Blast:MADS 256 289 3e-11 BLAST
low complexity region 300 314 N/A INTRINSIC
internal_repeat_1 335 360 6.39e-6 PROSPERO
low complexity region 368 383 N/A INTRINSIC
internal_repeat_1 450 473 6.39e-6 PROSPERO
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a ubiquitous nuclear protein that stimulates both cell proliferation and differentiation. It is a member of the MADS (MCM1, Agamous, Deficiens, and SRF) box superfamily of transcription factors. This protein binds to the serum response element (SRE) in the promoter region of target genes. This protein regulates the activity of many immediate-early genes, for example c-fos, and thereby participates in cell cycle regulation, apoptosis, cell growth, and cell differentiation. This gene is the downstream target of many pathways; for example, the mitogen-activated protein kinase pathway (MAPK) that acts through the ternary complex factors (TCFs). Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2014]
PHENOTYPE: Homozygous null mice exhibit embryonic lethality, abnormal gastrulation, no mesoderm or primitive streak formation and reduced embryo size. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930021J03Rik T C 19: 29,716,481 T1871A possibly damaging Het
Adgb T C 10: 10,472,241 D25G probably benign Het
Ak9 T C 10: 41,424,717 V1641A unknown Het
Akap2 T C 4: 57,855,816 S382P probably benign Het
Akirin2 T C 4: 34,562,435 I118T probably benign Het
Aldh1l1 G T 6: 90,563,379 Q215H probably benign Het
Arhgef26 T C 3: 62,419,550 F495L possibly damaging Het
Atg4a-ps T A 3: 103,645,747 R93* probably null Het
AW822073 T C 10: 58,223,657 Q425R unknown Het
Catsper3 A G 13: 55,798,849 I120V probably benign Het
Cavin2 A G 1: 51,289,420 Q12R possibly damaging Het
Cenpf A T 1: 189,684,991 F39Y probably damaging Het
Chfr T C 5: 110,143,636 Y107H probably benign Het
Cmtm1 CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT 8: 104,309,470 probably benign Het
Defb4 T A 8: 19,201,204 I29K possibly damaging Het
Dnah7c A G 1: 46,527,485 T619A probably benign Het
Emc3 A G 6: 113,517,920 L179P probably damaging Het
Eno3 G C 11: 70,658,604 V84L possibly damaging Het
Fam110a C T 2: 151,970,722 V43M probably damaging Het
Fam159a G T 4: 108,367,903 T154K probably benign Het
Fbxo30 T A 10: 11,290,116 L194* probably null Het
Galnt14 T C 17: 73,545,101 T108A probably benign Het
Glipr2 T C 4: 43,968,601 I51T probably benign Het
Gm1527 C T 3: 28,915,311 S270F possibly damaging Het
Gm3336 A G 8: 70,718,554 M1V probably null Het
Gm4744 T C 6: 40,950,376 D15G Het
Gm4763 C T 7: 24,725,999 probably null Het
Gm4924 G A 10: 82,378,699 C777Y unknown Het
Gm5901 G A 7: 105,378,201 G306S probably damaging Het
Gon4l T A 3: 88,895,692 N1203K possibly damaging Het
Gpr161 A T 1: 165,310,457 Y204F possibly damaging Het
Igsf10 T C 3: 59,328,905 E1285G probably benign Het
Irx6 T C 8: 92,677,366 L187P probably damaging Het
Itgb1bp1 A G 12: 21,272,088 Y117H probably benign Het
Itln1 C A 1: 171,530,575 D202Y possibly damaging Het
Kctd9 T C 14: 67,738,523 S242P probably benign Het
Lrrk2 A G 15: 91,801,885 H2143R probably benign Het
Lynx1 G A 15: 74,751,549 R50* probably null Het
Map10 A G 8: 125,671,853 I662V probably benign Het
Mlxipl T C 5: 135,133,851 L691P probably damaging Het
Muc16 A G 9: 18,643,004 S3998P unknown Het
Nalcn A T 14: 123,594,502 V120E probably damaging Het
Nfat5 T C 8: 107,358,691 S539P probably benign Het
Olfml3 T C 3: 103,737,168 M62V probably benign Het
Orm3 T C 4: 63,357,825 V158A probably benign Het
Pced1b A T 15: 97,384,598 K173* probably null Het
Pdzd7 T C 19: 45,027,949 D911G probably damaging Het
Pkn3 A G 2: 30,083,315 D383G probably damaging Het
Pm20d1 A G 1: 131,797,554 E46G probably benign Het
Pyroxd2 A T 19: 42,731,403 S455T probably benign Het
Rmnd5b T A 11: 51,624,537 I301F possibly damaging Het
Rnf225 A G 7: 12,927,984 N30S probably benign Het
Slfn3 T A 11: 83,214,895 C573S probably benign Het
Smc6 A G 12: 11,301,631 E887G probably damaging Het
Sp140 A T 1: 85,620,125 D191V possibly damaging Het
Sult6b1 T C 17: 78,894,641 D144G probably damaging Het
Syne1 G A 10: 5,243,180 A3956V probably damaging Het
Syt10 A T 15: 89,814,111 D343E probably damaging Het
Tgtp2 G A 11: 49,059,308 R146C possibly damaging Het
Tmcc3 A T 10: 94,430,634 probably benign Het
Tnfrsf1a A T 6: 125,361,536 T337S probably benign Het
Tns1 A T 1: 73,995,304 I144N Het
Trim11 A G 11: 58,978,277 E13G probably damaging Het
Trpm6 A T 19: 18,811,773 H569L possibly damaging Het
Ttbk2 T A 2: 120,746,088 I803L probably benign Het
Vmn1r21 G T 6: 57,843,951 N169K probably damaging Het
Vmn2r60 C T 7: 42,195,112 T633I probably damaging Het
Wt1 T C 2: 105,127,325 Y177H probably benign Het
Other mutations in Srf
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01836:Srf APN 17 46549182 unclassified probably benign
IGL02448:Srf APN 17 46555423 missense possibly damaging 0.47
R0277:Srf UTSW 17 46549489 missense possibly damaging 0.54
R0323:Srf UTSW 17 46549489 missense possibly damaging 0.54
R1633:Srf UTSW 17 46551608 missense probably damaging 1.00
R1807:Srf UTSW 17 46553759 missense possibly damaging 0.88
R1930:Srf UTSW 17 46549986 missense probably damaging 1.00
R1932:Srf UTSW 17 46549986 missense probably damaging 1.00
R1951:Srf UTSW 17 46551707 missense possibly damaging 0.94
R4851:Srf UTSW 17 46549474 missense probably benign 0.33
R7017:Srf UTSW 17 46550904 missense probably benign 0.18
R7177:Srf UTSW 17 46555392 missense probably damaging 0.99
R7315:Srf UTSW 17 46551794 critical splice acceptor site probably null
R8019:Srf UTSW 17 46555822 missense unknown
R8678:Srf UTSW 17 46550899 critical splice donor site probably null
R8927:Srf UTSW 17 46549169 missense probably damaging 1.00
R8928:Srf UTSW 17 46549169 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACACACCTCCTGCGGACTAG -3'
(R):5'- GCCATGTTACCGAGCCAAG -3'

Sequencing Primer
(F):5'- GCTACCTTAGAGCGCACC -3'
(R):5'- AGAGTCGTCTGGAGCGG -3'
Posted On 2019-05-15