Incidental Mutation 'R7150:Trpc7'
ID554084
Institutional Source Beutler Lab
Gene Symbol Trpc7
Ensembl Gene ENSMUSG00000021541
Gene Nametransient receptor potential cation channel, subfamily C, member 7
SynonymsTrrp8, TRP7
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.137) question?
Stock #R7150 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location56773113-56895993 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 56783696 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Lysine at position 730 (I730K)
Ref Sequence ENSEMBL: ENSMUSP00000022023 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022023] [ENSMUST00000109871] [ENSMUST00000151918] [ENSMUST00000173817] [ENSMUST00000174457]
Predicted Effect probably benign
Transcript: ENSMUST00000022023
AA Change: I730K

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000022023
Gene: ENSMUSG00000021541
AA Change: I730K

DomainStartEndE-ValueType
ANK 42 71 1.53e3 SMART
ANK 77 105 1.97e1 SMART
ANK 163 192 1.32e0 SMART
Pfam:TRP_2 198 260 6e-28 PFAM
transmembrane domain 352 374 N/A INTRINSIC
Pfam:Ion_trans 387 684 2.4e-34 PFAM
Pfam:PKD_channel 427 679 5.5e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000109871
AA Change: I730K

PolyPhen 2 Score 0.021 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000105497
Gene: ENSMUSG00000021541
AA Change: I730K

DomainStartEndE-ValueType
ANK 42 71 1.53e3 SMART
ANK 77 105 1.97e1 SMART
ANK 163 192 1.32e0 SMART
Pfam:TRP_2 198 260 1.1e-31 PFAM
transmembrane domain 352 374 N/A INTRINSIC
transmembrane domain 389 406 N/A INTRINSIC
Pfam:PKD_channel 427 679 1.6e-13 PFAM
Pfam:Ion_trans 441 672 7e-36 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000151918
SMART Domains Protein: ENSMUSP00000119809
Gene: ENSMUSG00000021541

DomainStartEndE-ValueType
ANK 42 71 1.53e3 SMART
ANK 77 105 1.97e1 SMART
ANK 163 192 1.32e0 SMART
Pfam:TRP_2 198 260 4.6e-32 PFAM
transmembrane domain 352 374 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000173067
SMART Domains Protein: ENSMUSP00000134481
Gene: ENSMUSG00000021541

DomainStartEndE-ValueType
ANK 42 71 1.53e3 SMART
ANK 77 105 1.97e1 SMART
ANK 163 192 1.32e0 SMART
Pfam:TRP_2 198 260 5.1e-32 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000173466
SMART Domains Protein: ENSMUSP00000134285
Gene: ENSMUSG00000021541

DomainStartEndE-ValueType
ANK 42 71 1.53e3 SMART
ANK 77 105 1.97e1 SMART
ANK 163 192 1.32e0 SMART
Pfam:TRP_2 198 260 9.5e-32 PFAM
transmembrane domain 352 374 N/A INTRINSIC
Predicted Effect
SMART Domains Protein: ENSMUSP00000134662
Gene: ENSMUSG00000021541
AA Change: I613K

DomainStartEndE-ValueType
ANK 42 71 1.53e3 SMART
ANK 77 105 1.97e1 SMART
ANK 163 192 1.32e0 SMART
Pfam:TRP_2 198 260 2.5e-31 PFAM
Pfam:PKD_channel 311 563 2.6e-13 PFAM
Pfam:Ion_trans 325 556 1.1e-35 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000173817
AA Change: I669K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000133411
Gene: ENSMUSG00000021541
AA Change: I669K

DomainStartEndE-ValueType
ANK 42 71 1.53e3 SMART
ANK 77 105 1.97e1 SMART
ANK 163 192 1.32e0 SMART
Pfam:TRP_2 198 260 2.7e-31 PFAM
transmembrane domain 291 313 N/A INTRINSIC
transmembrane domain 328 345 N/A INTRINSIC
Pfam:PKD_channel 366 618 3.7e-13 PFAM
Pfam:Ion_trans 380 611 1.2e-35 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000174457
AA Change: I675K

PolyPhen 2 Score 0.882 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000133305
Gene: ENSMUSG00000021541
AA Change: I675K

DomainStartEndE-ValueType
ANK 42 71 1.53e3 SMART
ANK 77 105 1.97e1 SMART
ANK 163 192 1.32e0 SMART
Pfam:TRP_2 198 260 2.7e-31 PFAM
Pfam:PKD_channel 372 624 3.8e-13 PFAM
Pfam:Ion_trans 386 617 1.3e-35 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 98% (59/60)
MGI Phenotype FUNCTION: The protein encoded by this gene is a member of the transient receptor potential channel family of proteins, which form six-transmembrane cation-permeable channels that are calcium permeant. Knock out mice are viable but display a reduction in the gamma wave activity that precedes seizure induction in response to a muscrarinic agonist, suggesting a functional role for this protein in initiation of seizures. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit abnormal eye physiology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810004N23Rik T C 8: 124,862,914 D20G possibly damaging Het
5430401F13Rik T C 6: 131,552,667 S75P probably benign Het
9530003J23Rik T C 10: 117,237,742 N62S probably benign Het
Acad8 A T 9: 26,978,454 F315I probably damaging Het
Adcy5 A G 16: 35,298,534 Y1085C probably damaging Het
Aldh1a7 T C 19: 20,716,018 K179R probably damaging Het
Arhgap10 C T 8: 77,250,954 G776R probably damaging Het
Arhgap35 A C 7: 16,562,566 F858C probably damaging Het
Ash1l C T 3: 89,077,074 R2957W probably damaging Het
Atp6ap1l G T 13: 90,883,729 A278E probably damaging Het
Btn1a1 A T 13: 23,459,351 D309E probably damaging Het
Casd1 C T 6: 4,624,211 R335C probably benign Het
Ceacam3 A G 7: 17,151,562 Q30R Het
Cfap20 C T 8: 95,422,167 C119Y probably damaging Het
Cntrl A T 2: 35,165,445 probably null Het
Crot A G 5: 8,987,878 V146A probably damaging Het
Cx3cl1 A G 8: 94,779,963 S199G probably damaging Het
D5Ertd577e A G 5: 95,482,821 I186V possibly damaging Het
Ddhd1 A T 14: 45,657,806 L69Q probably damaging Het
Dnah12 T C 14: 26,861,732 F3195L probably damaging Het
Dpy19l3 A T 7: 35,708,630 D450E probably benign Het
Ercc3 A T 18: 32,257,272 N538I probably damaging Het
Fzd1 A T 5: 4,756,145 V479E probably benign Het
Gart T C 16: 91,628,463 Y638C possibly damaging Het
Gm2381 C A 7: 42,820,464 V79L probably benign Het
Gucy1b1 T C 3: 82,043,162 Y312C probably damaging Het
Hecw1 T A 13: 14,434,460 M1L probably benign Het
Ip6k2 A G 9: 108,796,731 I99V unknown Het
Itgb5 C T 16: 33,940,643 T616I probably benign Het
Kmt2c A C 5: 25,300,362 V3316G possibly damaging Het
Lama3 C T 18: 12,468,289 R1008C probably damaging Het
Lin54 T C 5: 100,485,300 D175G possibly damaging Het
Lrp2 A G 2: 69,488,051 S2019P probably damaging Het
Lrrc9 A G 12: 72,466,952 E528G probably benign Het
Mto1 A G 9: 78,457,283 H299R probably damaging Het
Myo19 G A 11: 84,905,613 G684R probably benign Het
Olfr297 A C 7: 86,527,114 D119A probably damaging Het
Olfr851 A T 9: 19,496,849 M34L probably benign Het
Pcdh18 C A 3: 49,754,694 C724F probably benign Het
Pcdha3 A T 18: 36,947,112 K302N probably benign Het
Pcdhgb2 T C 18: 37,692,247 F764L possibly damaging Het
Pik3cb C A 9: 99,093,090 G246W probably damaging Het
Polr2m A T 9: 71,483,344 I192N probably damaging Het
Polr2m G T 9: 71,483,533 T129K probably benign Het
Ptpn4 C T 1: 119,691,745 probably null Het
Scgb1b19 A T 7: 33,287,515 K30N possibly damaging Het
Shpk A G 11: 73,213,489 T155A probably damaging Het
Slit3 T C 11: 35,570,719 Y261H probably damaging Het
Sox13 A G 1: 133,385,505 F438L possibly damaging Het
Sphk1 A T 11: 116,535,081 E61D probably benign Het
St18 A G 1: 6,803,019 D326G probably damaging Het
Syde1 G A 10: 78,586,198 Q566* probably null Het
Tacc2 A G 7: 130,729,077 T254A probably benign Het
Tbc1d1 A G 5: 64,173,484 E2G probably damaging Het
Trim5 A T 7: 104,276,810 N181K probably damaging Het
Uqcrc1 T A 9: 108,947,858 M377K probably benign Het
Vmn2r4 T C 3: 64,398,477 N508S probably benign Het
Vmp1 A T 11: 86,586,576 S333T probably benign Het
Vps50 T A 6: 3,578,854 M639K possibly damaging Het
Zfp874b A T 13: 67,474,503 C225* probably null Het
Other mutations in Trpc7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00538:Trpc7 APN 13 56773809 missense possibly damaging 0.64
IGL00809:Trpc7 APN 13 56822488 missense probably benign 0.00
IGL01011:Trpc7 APN 13 56804540 missense probably damaging 1.00
IGL01517:Trpc7 APN 13 56861065 missense probably damaging 1.00
IGL01824:Trpc7 APN 13 56789722 nonsense probably null
IGL02055:Trpc7 APN 13 56887544 missense probably benign 0.13
IGL02267:Trpc7 APN 13 56860930 missense probably damaging 1.00
IGL02323:Trpc7 APN 13 56783751 missense possibly damaging 0.91
IGL02451:Trpc7 APN 13 56822461 missense probably damaging 0.98
IGL02635:Trpc7 APN 13 56776168 missense probably damaging 1.00
IGL03335:Trpc7 APN 13 56887691 missense probably damaging 1.00
PIT4305001:Trpc7 UTSW 13 56887508 missense probably benign 0.00
R0217:Trpc7 UTSW 13 56789768 nonsense probably null
R0611:Trpc7 UTSW 13 56887823 missense probably damaging 1.00
R0919:Trpc7 UTSW 13 56822649 splice site probably benign
R1235:Trpc7 UTSW 13 56887539 missense probably damaging 1.00
R1751:Trpc7 UTSW 13 56776143 missense probably damaging 1.00
R4324:Trpc7 UTSW 13 56887356 missense probably damaging 0.99
R4649:Trpc7 UTSW 13 56887554 missense probably damaging 1.00
R4731:Trpc7 UTSW 13 56804553 missense probably damaging 1.00
R5379:Trpc7 UTSW 13 56804550 missense probably damaging 1.00
R5834:Trpc7 UTSW 13 56776158 missense probably damaging 1.00
R5985:Trpc7 UTSW 13 56810545 missense probably damaging 0.96
R6244:Trpc7 UTSW 13 56773892 missense probably damaging 1.00
R6599:Trpc7 UTSW 13 56810380 splice site probably null
R6778:Trpc7 UTSW 13 56804687 missense probably damaging 1.00
R7140:Trpc7 UTSW 13 56789674 nonsense probably null
R7156:Trpc7 UTSW 13 56789766 missense possibly damaging 0.61
R7238:Trpc7 UTSW 13 56826897 missense probably benign 0.17
R7716:Trpc7 UTSW 13 56789760 missense probably damaging 1.00
R7739:Trpc7 UTSW 13 56773766 makesense probably null
R8114:Trpc7 UTSW 13 56804598 missense probably benign 0.14
R8143:Trpc7 UTSW 13 56782549 missense probably benign 0.01
Z1177:Trpc7 UTSW 13 56810444 missense probably benign 0.00
Z1177:Trpc7 UTSW 13 56822432 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GTCAAACACAGTCTCCCCTG -3'
(R):5'- GGTCTCTGACTCATGTGACTG -3'

Sequencing Primer
(F):5'- ACAGTCTCCCCTGCTCCTC -3'
(R):5'- GTATCCTCGTTTCGCAGGAAGAC -3'
Posted On2019-05-15