Incidental Mutation 'R7171:Notch3'
ID558309
Institutional Source Beutler Lab
Gene Symbol Notch3
Ensembl Gene ENSMUSG00000038146
Gene Namenotch 3
SynonymsN3, hpbk
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7171 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location32120820-32166880 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 32158962 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Aspartic acid at position 74 (G74D)
Ref Sequence ENSEMBL: ENSMUSP00000085016 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087723]
Predicted Effect probably damaging
Transcript: ENSMUST00000087723
AA Change: G74D

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000085016
Gene: ENSMUSG00000038146
AA Change: G74D

DomainStartEndE-ValueType
signal peptide 1 39 N/A INTRINSIC
EGF 42 78 3.73e-5 SMART
EGF 82 119 1.78e-2 SMART
EGF 123 157 1.13e-4 SMART
EGF_CA 159 196 1.89e-15 SMART
EGF 201 235 3.85e-7 SMART
EGF_CA 237 273 3.97e-9 SMART
EGF_CA 275 313 4.63e-10 SMART
EGF_CA 315 351 1.05e-8 SMART
EGF 355 390 1.28e-3 SMART
EGF_CA 392 430 6.29e-12 SMART
EGF_CA 432 468 1.11e-12 SMART
EGF_CA 470 506 4.21e-13 SMART
EGF_CA 508 544 8.43e-13 SMART
EGF_CA 546 581 9.54e-12 SMART
EGF_CA 583 619 1.31e-9 SMART
EGF_CA 621 656 2.03e-6 SMART
EGF_CA 658 694 2.28e-9 SMART
EGF 699 731 7.18e-7 SMART
EGF 738 771 2.5e-6 SMART
EGF 775 809 8e-5 SMART
EGF_CA 811 848 4.77e-12 SMART
EGF_CA 850 886 3.81e-11 SMART
EGF_CA 888 923 1.47e-12 SMART
EGF_CA 925 961 3.4e-8 SMART
EGF 966 999 5.74e-6 SMART
EGF 1004 1035 7.18e-7 SMART
EGF 1040 1083 1.21e-4 SMART
EGF_CA 1085 1121 1.29e-8 SMART
EGF_CA 1123 1159 1.45e-11 SMART
EGF_CA 1161 1204 1.26e-11 SMART
EGF 1209 1245 1.53e-1 SMART
EGF 1250 1288 8e-5 SMART
EGF 1293 1326 1.13e1 SMART
EGF 1339 1374 5.36e-6 SMART
NL 1381 1419 1.63e-15 SMART
NL 1422 1460 1.78e-16 SMART
NL 1461 1502 1.75e-15 SMART
NOD 1506 1562 2.98e-24 SMART
NODP 1577 1641 1.34e-26 SMART
transmembrane domain 1644 1666 N/A INTRINSIC
low complexity region 1774 1783 N/A INTRINSIC
ANK 1789 1834 1.48e3 SMART
ANK 1839 1868 1.61e-4 SMART
ANK 1872 1902 1.42e0 SMART
ANK 1906 1935 1.77e-1 SMART
ANK 1939 1968 3.18e-3 SMART
ANK 1972 2001 5.16e-3 SMART
low complexity region 2028 2054 N/A INTRINSIC
low complexity region 2108 2123 N/A INTRINSIC
low complexity region 2169 2193 N/A INTRINSIC
DUF3454 2218 2275 2.81e-20 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (81/81)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the third discovered human homologue of the Drosophilia melanogaster type I membrane protein notch. In Drosophilia, notch interaction with its cell-bound ligands (delta, serrate) establishes an intercellular signalling pathway that plays a key role in neural development. Homologues of the notch-ligands have also been identified in human, but precise interactions between these ligands and the human notch homologues remains to be determined. Mutations in NOTCH3 have been identified as the underlying cause of cerebral autosomal dominant arteriopathy with subcortical infarcts and leukoencephalopathy (CADASIL). [provided by RefSeq, Jul 2008]
PHENOTYPE: Some, but not all, null alleles cause defects in artery morphology and in T cell development. Progressive emaciation and kyphosis with paraphimosis occurs in an intron 31 splice donor site point mutant. In conjunction with Notch1 deficiency, abnormalities in embryonic development have been observed. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930519P11Rik T C 2: 154,612,977 N154S unknown Het
9530053A07Rik T A 7: 28,154,519 L1636* probably null Het
Ank3 C T 10: 69,992,481 H2327Y Het
Ano6 A G 15: 95,920,291 Y305C probably damaging Het
Apc2 A G 10: 80,315,336 T2075A possibly damaging Het
Arl6 A G 16: 59,623,092 V93A possibly damaging Het
Bcas3 T C 11: 85,583,937 S790P probably damaging Het
Bcl9l C A 9: 44,505,151 H211N probably benign Het
Bptf G T 11: 107,131,407 D172E unknown Het
Card9 T G 2: 26,359,484 I22L possibly damaging Het
Catsperg1 C A 7: 29,185,212 G933V probably damaging Het
Catsperg2 T A 7: 29,705,325 H771L possibly damaging Het
Ccdc66 T C 14: 27,493,272 N281S possibly damaging Het
Cfap54 A T 10: 92,776,210 L3162H probably damaging Het
Clca4a A G 3: 144,958,173 L503P probably benign Het
Cpn1 T C 19: 43,974,031 N160D probably damaging Het
Ctsh T A 9: 90,067,101 I206K probably benign Het
Cyb561d1 G A 3: 108,199,363 T180M probably damaging Het
Dapk1 A T 13: 60,761,785 D1404V probably damaging Het
Dip2c G T 13: 9,506,648 R76L probably benign Het
Dnah7c T C 1: 46,680,738 I2783T probably damaging Het
E130308A19Rik T C 4: 59,690,333 Y56H probably damaging Het
Efemp2 G T 19: 5,480,257 A310S probably benign Het
Enpp5 G A 17: 44,085,264 G356S probably damaging Het
Faap24 G A 7: 35,392,854 Q213* probably null Het
Fam181b G A 7: 93,080,735 G239S possibly damaging Het
Fancm T C 12: 65,101,620 W670R probably damaging Het
Fmnl1 T C 11: 103,190,398 Y357H probably damaging Het
Fryl A T 5: 73,122,310 V215E probably damaging Het
Fscn2 C A 11: 120,362,509 N267K probably damaging Het
Fsip2 T A 2: 82,986,227 Y4101* probably null Het
Gcn1l1 G A 5: 115,590,293 V738I probably benign Het
Gdf9 C T 11: 53,437,539 R441C probably damaging Het
Gipc3 C T 10: 81,341,621 G79E probably damaging Het
Gzmf T A 14: 56,205,934 I196L probably benign Het
Hectd1 A T 12: 51,759,297 V1852E probably damaging Het
Hip1r A T 5: 123,995,944 Q256L probably benign Het
Hmgxb4 T C 8: 75,020,262 S405P probably damaging Het
Il9r T A 11: 32,192,671 H294L probably benign Het
Kif12 G A 4: 63,168,694 T331I probably damaging Het
Krtap8-1 A T 16: 89,487,906 M1K probably null Het
Lamc2 A T 1: 153,139,749 C613S probably damaging Het
Lgr4 T A 2: 110,000,969 N314K probably benign Het
Lpcat2 T C 8: 92,909,266 I432T probably benign Het
Mfhas1 T C 8: 35,588,992 V207A probably benign Het
Msh3 T G 13: 92,349,298 T173P probably benign Het
Mup15 T A 4: 61,438,268 M87L probably benign Het
N4bp2 T C 5: 65,808,022 V1138A probably benign Het
Noc2l T C 4: 156,241,722 V422A probably benign Het
Ocstamp T A 2: 165,398,161 K35I probably benign Het
Olfr360 T C 2: 37,068,388 F28L possibly damaging Het
Olfr459 T G 6: 41,772,027 T91P probably benign Het
Olfr482 A G 7: 108,095,135 V145A probably benign Het
Olfr692 A G 7: 105,368,761 H145R probably benign Het
Plekhh2 T A 17: 84,521,788 V29D probably damaging Het
Pof1b A G X: 112,644,345 I544T probably benign Het
Rad54l2 C T 9: 106,713,478 R483H probably damaging Het
Rapgef6 T A 11: 54,676,363 D1128E possibly damaging Het
Rhbdl2 T A 4: 123,814,256 I86N possibly damaging Het
Rims1 C A 1: 22,428,489 R68L Het
Rnf157 A G 11: 116,362,373 F70L possibly damaging Het
Rtp3 C T 9: 110,985,941 C452Y unknown Het
S100a14 A T 3: 90,527,762 K27* probably null Het
Scai C T 2: 39,106,936 G282D possibly damaging Het
Sclt1 A T 3: 41,717,760 I132N probably benign Het
Serpinf1 T A 11: 75,417,985 Q2L possibly damaging Het
Skor2 T A 18: 76,860,986 V801E probably benign Het
Slc16a10 C G 10: 40,037,259 E484D probably benign Het
Slc1a5 T A 7: 16,797,538 D489E probably damaging Het
Slx4 C T 16: 3,990,786 R430H probably benign Het
Teddm1b A T 1: 153,874,933 I163F probably damaging Het
Tmem171 A T 13: 98,692,236 C135* probably null Het
Tmem82 C T 4: 141,614,973 R306H possibly damaging Het
Tmem94 T A 11: 115,790,955 probably null Het
Trpm2 A C 10: 77,924,014 L1096R probably damaging Het
Trrap T A 5: 144,794,049 L780Q probably damaging Het
Txlnb A G 10: 17,842,984 D521G probably benign Het
Usp7 T C 16: 8,716,526 D59G probably benign Het
Vcan G A 13: 89,725,591 T48I probably damaging Het
Vmn1r45 A G 6: 89,933,334 L218P probably damaging Het
Wdr25 A T 12: 109,024,996 T370S probably damaging Het
Other mutations in Notch3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00161:Notch3 APN 17 32158114 nonsense probably null
IGL01065:Notch3 APN 17 32146416 nonsense probably null
IGL01296:Notch3 APN 17 32166757 missense unknown
IGL01322:Notch3 APN 17 32144471 missense probably damaging 1.00
IGL01343:Notch3 APN 17 32143436 missense probably benign 0.10
IGL01358:Notch3 APN 17 32144747 missense probably damaging 1.00
IGL01600:Notch3 APN 17 32144498 missense probably damaging 1.00
IGL01622:Notch3 APN 17 32158870 missense possibly damaging 0.50
IGL01623:Notch3 APN 17 32158870 missense possibly damaging 0.50
IGL01971:Notch3 APN 17 32124347 missense probably damaging 1.00
IGL02000:Notch3 APN 17 32122742 missense probably damaging 0.99
IGL02072:Notch3 APN 17 32147074 nonsense probably null
IGL02145:Notch3 APN 17 32154741 missense probably benign 0.01
IGL02256:Notch3 APN 17 32132324 missense probably damaging 1.00
IGL02366:Notch3 APN 17 32144205 missense probably benign
IGL02476:Notch3 APN 17 32158638 missense possibly damaging 0.67
IGL02502:Notch3 APN 17 32158278 nonsense probably null
IGL02551:Notch3 APN 17 32154731 splice site probably benign
divide UTSW 17 32137813 splice site probably null
Lopressor UTSW 17 32153884 missense probably damaging 1.00
PIT4486001:Notch3 UTSW 17 32154763 missense probably damaging 1.00
R0115:Notch3 UTSW 17 32133462 missense possibly damaging 0.82
R0201:Notch3 UTSW 17 32156148 splice site probably benign
R0630:Notch3 UTSW 17 32147472 splice site probably benign
R1167:Notch3 UTSW 17 32122745 missense possibly damaging 0.95
R1432:Notch3 UTSW 17 32164224 missense probably benign
R1567:Notch3 UTSW 17 32158580 missense possibly damaging 0.77
R1623:Notch3 UTSW 17 32139191 missense probably benign 0.00
R1663:Notch3 UTSW 17 32156119 missense probably damaging 1.00
R1668:Notch3 UTSW 17 32158589 missense probably damaging 0.99
R1789:Notch3 UTSW 17 32158725 missense probably damaging 1.00
R1813:Notch3 UTSW 17 32143428 missense probably benign 0.08
R1837:Notch3 UTSW 17 32124322 missense probably damaging 1.00
R1896:Notch3 UTSW 17 32143428 missense probably benign 0.08
R1937:Notch3 UTSW 17 32153852 missense probably benign 0.03
R1954:Notch3 UTSW 17 32166678 missense probably benign
R2014:Notch3 UTSW 17 32158000 missense probably benign 0.00
R2058:Notch3 UTSW 17 32143644 missense probably benign
R2068:Notch3 UTSW 17 32135508 missense probably benign 0.00
R2097:Notch3 UTSW 17 32122754 missense probably damaging 1.00
R2112:Notch3 UTSW 17 32144610 missense probably benign 0.19
R2156:Notch3 UTSW 17 32147844 missense probably damaging 1.00
R2211:Notch3 UTSW 17 32147978 missense probably benign 0.00
R2324:Notch3 UTSW 17 32150134 splice site probably benign
R2432:Notch3 UTSW 17 32153804 missense probably damaging 1.00
R3117:Notch3 UTSW 17 32158115 missense probably damaging 1.00
R3236:Notch3 UTSW 17 32158461 missense probably damaging 0.96
R3409:Notch3 UTSW 17 32150702 missense possibly damaging 0.67
R3434:Notch3 UTSW 17 32158618 missense possibly damaging 0.80
R3435:Notch3 UTSW 17 32158618 missense possibly damaging 0.80
R3438:Notch3 UTSW 17 32153590 missense probably damaging 1.00
R3926:Notch3 UTSW 17 32153557 missense possibly damaging 0.92
R4087:Notch3 UTSW 17 32158113 missense possibly damaging 0.60
R4115:Notch3 UTSW 17 32158433 missense probably damaging 1.00
R4214:Notch3 UTSW 17 32132207 missense possibly damaging 0.96
R4234:Notch3 UTSW 17 32141341 missense probably damaging 0.97
R4242:Notch3 UTSW 17 32143745 missense possibly damaging 0.74
R4658:Notch3 UTSW 17 32154763 missense probably damaging 1.00
R4878:Notch3 UTSW 17 32147085 missense probably damaging 1.00
R4879:Notch3 UTSW 17 32147963 missense probably benign 0.00
R4885:Notch3 UTSW 17 32141377 missense probably damaging 0.98
R4924:Notch3 UTSW 17 32144731 missense probably damaging 1.00
R5084:Notch3 UTSW 17 32157890 critical splice donor site probably null
R5086:Notch3 UTSW 17 32143334 missense probably benign 0.13
R5343:Notch3 UTSW 17 32143283 missense probably benign 0.03
R5389:Notch3 UTSW 17 32139189 missense probably benign
R5503:Notch3 UTSW 17 32147055 missense probably benign 0.00
R5698:Notch3 UTSW 17 32157987 missense probably damaging 1.00
R5824:Notch3 UTSW 17 32153861 missense possibly damaging 0.92
R5969:Notch3 UTSW 17 32153884 missense probably damaging 1.00
R6050:Notch3 UTSW 17 32143527 missense probably benign
R6274:Notch3 UTSW 17 32147290 missense probably benign
R6276:Notch3 UTSW 17 32154749 missense probably benign 0.10
R6313:Notch3 UTSW 17 32151154 intron probably null
R6316:Notch3 UTSW 17 32137813 splice site probably null
R6380:Notch3 UTSW 17 32144559 missense probably damaging 1.00
R6401:Notch3 UTSW 17 32158623 missense probably benign 0.01
R6502:Notch3 UTSW 17 32158217 missense probably damaging 1.00
R6741:Notch3 UTSW 17 32143484 missense probably benign 0.16
R7131:Notch3 UTSW 17 32144217 missense probably benign
R7140:Notch3 UTSW 17 32156377 missense possibly damaging 0.84
R7162:Notch3 UTSW 17 32146449 missense probably damaging 0.98
R7449:Notch3 UTSW 17 32157966 missense probably damaging 1.00
R7450:Notch3 UTSW 17 32141391 missense possibly damaging 0.69
R7554:Notch3 UTSW 17 32122371 missense probably benign 0.03
R7575:Notch3 UTSW 17 32154819 missense possibly damaging 0.81
R7632:Notch3 UTSW 17 32158506 missense probably benign
R7633:Notch3 UTSW 17 32158622 missense probably benign 0.17
T0975:Notch3 UTSW 17 32146417 missense probably damaging 0.99
Z1088:Notch3 UTSW 17 32158652 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- ACATTCTCGCCTACCAAGGG -3'
(R):5'- GCAGGTAAATTACTGTGAATTCCAGTC -3'

Sequencing Primer
(F):5'- TACCAAGGGTTCCCGTCCAG -3'
(R):5'- TCCAGTCTAGCCAGCGATATGTAG -3'
Posted On2019-06-26