Mutagenetix > Incidental Mutations

Incidental Mutation 'R7171:Notch3'

558309

Institutional Source

Beutler Lab

Gene Symbol

Notch3

Ensembl Gene

ENSMUSG00000038146

Gene Name

notch 3

Synonyms

N3, hpbk

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7171 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

32120820-32166880 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 32158962 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glycine to Aspartic acid at position 74 (G74D)

Ref Sequence

ENSEMBL: ENSMUSP00000085016 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000087723]

AlphaFold

Q61982

Predicted Effect

probably damaging
Transcript: ENSMUST00000087723
AA Change: G74D

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000085016
Gene: ENSMUSG00000038146
AA Change: G74D

Domain	Start	End	E-Value	Type
signal peptide	1	39	N/A	INTRINSIC
EGF	42	78	3.73e-5	SMART
EGF	82	119	1.78e-2	SMART
EGF	123	157	1.13e-4	SMART
EGF_CA	159	196	1.89e-15	SMART
EGF	201	235	3.85e-7	SMART
EGF_CA	237	273	3.97e-9	SMART
EGF_CA	275	313	4.63e-10	SMART
EGF_CA	315	351	1.05e-8	SMART
EGF	355	390	1.28e-3	SMART
EGF_CA	392	430	6.29e-12	SMART
EGF_CA	432	468	1.11e-12	SMART
EGF_CA	470	506	4.21e-13	SMART
EGF_CA	508	544	8.43e-13	SMART
EGF_CA	546	581	9.54e-12	SMART
EGF_CA	583	619	1.31e-9	SMART
EGF_CA	621	656	2.03e-6	SMART
EGF_CA	658	694	2.28e-9	SMART
EGF	699	731	7.18e-7	SMART
EGF	738	771	2.5e-6	SMART
EGF	775	809	8e-5	SMART
EGF_CA	811	848	4.77e-12	SMART
EGF_CA	850	886	3.81e-11	SMART
EGF_CA	888	923	1.47e-12	SMART
EGF_CA	925	961	3.4e-8	SMART
EGF	966	999	5.74e-6	SMART
EGF	1004	1035	7.18e-7	SMART
EGF	1040	1083	1.21e-4	SMART
EGF_CA	1085	1121	1.29e-8	SMART
EGF_CA	1123	1159	1.45e-11	SMART
EGF_CA	1161	1204	1.26e-11	SMART
EGF	1209	1245	1.53e-1	SMART
EGF	1250	1288	8e-5	SMART
EGF	1293	1326	1.13e1	SMART
EGF	1339	1374	5.36e-6	SMART
NL	1381	1419	1.63e-15	SMART
NL	1422	1460	1.78e-16	SMART
NL	1461	1502	1.75e-15	SMART
NOD	1506	1562	2.98e-24	SMART
NODP	1577	1641	1.34e-26	SMART
transmembrane domain	1644	1666	N/A	INTRINSIC
low complexity region	1774	1783	N/A	INTRINSIC
ANK	1789	1834	1.48e3	SMART
ANK	1839	1868	1.61e-4	SMART
ANK	1872	1902	1.42e0	SMART
ANK	1906	1935	1.77e-1	SMART
ANK	1939	1968	3.18e-3	SMART
ANK	1972	2001	5.16e-3	SMART
low complexity region	2028	2054	N/A	INTRINSIC
low complexity region	2108	2123	N/A	INTRINSIC
low complexity region	2169	2193	N/A	INTRINSIC
DUF3454	2218	2275	2.81e-20	SMART

Meta Mutation Damage Score

0.8442

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 98.9%

Validation Efficiency

100% (81/81)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the third discovered human homologue of the Drosophilia melanogaster type I membrane protein notch. In Drosophilia, notch interaction with its cell-bound ligands (delta, serrate) establishes an intercellular signalling pathway that plays a key role in neural development. Homologues of the notch-ligands have also been identified in human, but precise interactions between these ligands and the human notch homologues remains to be determined. Mutations in NOTCH3 have been identified as the underlying cause of cerebral autosomal dominant arteriopathy with subcortical infarcts and leukoencephalopathy (CADASIL). [provided by RefSeq, Jul 2008]
PHENOTYPE: Some, but not all, null alleles cause defects in artery morphology and in T cell development. Progressive emaciation and kyphosis with paraphimosis occurs in an intron 31 splice donor site point mutant. In conjunction with Notch1 deficiency, abnormalities in embryonic development have been observed. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 81 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930519P11Rik	T	C	2: 154,612,977	N154S	unknown	Het
9530053A07Rik	T	A	7: 28,154,519	L1636*	probably null	Het
Ank3	C	T	10: 69,992,481	H2327Y		Het
Ano6	A	G	15: 95,920,291	Y305C	probably damaging	Het
Apc2	A	G	10: 80,315,336	T2075A	possibly damaging	Het
Arl6	A	G	16: 59,623,092	V93A	possibly damaging	Het
Bcas3	T	C	11: 85,583,937	S790P	probably damaging	Het
Bcl9l	C	A	9: 44,505,151	H211N	probably benign	Het
Bptf	G	T	11: 107,131,407	D172E	unknown	Het
Card9	T	G	2: 26,359,484	I22L	possibly damaging	Het
Catsperg1	C	A	7: 29,185,212	G933V	probably damaging	Het
Catsperg2	T	A	7: 29,705,325	H771L	possibly damaging	Het
Ccdc66	T	C	14: 27,493,272	N281S	possibly damaging	Het
Cfap54	A	T	10: 92,776,210	L3162H	probably damaging	Het
Clca4a	A	G	3: 144,958,173	L503P	probably benign	Het
Cpn1	T	C	19: 43,974,031	N160D	probably damaging	Het
Ctsh	T	A	9: 90,067,101	I206K	probably benign	Het
Cyb561d1	G	A	3: 108,199,363	T180M	probably damaging	Het
Dapk1	A	T	13: 60,761,785	D1404V	probably damaging	Het
Dip2c	G	T	13: 9,506,648	R76L	probably benign	Het
Dnah7c	T	C	1: 46,680,738	I2783T	probably damaging	Het
E130308A19Rik	T	C	4: 59,690,333	Y56H	probably damaging	Het
Efemp2	G	T	19: 5,480,257	A310S	probably benign	Het
Enpp5	G	A	17: 44,085,264	G356S	probably damaging	Het
Faap24	G	A	7: 35,392,854	Q213*	probably null	Het
Fam181b	G	A	7: 93,080,735	G239S	possibly damaging	Het
Fancm	T	C	12: 65,101,620	W670R	probably damaging	Het
Fmnl1	T	C	11: 103,190,398	Y357H	probably damaging	Het
Fryl	A	T	5: 73,122,310	V215E	probably damaging	Het
Fscn2	C	A	11: 120,362,509	N267K	probably damaging	Het
Fsip2	T	A	2: 82,986,227	Y4101*	probably null	Het
Gcn1l1	G	A	5: 115,590,293	V738I	probably benign	Het
Gdf9	C	T	11: 53,437,539	R441C	probably damaging	Het
Gipc3	C	T	10: 81,341,621	G79E	probably damaging	Het
Gzmf	T	A	14: 56,205,934	I196L	probably benign	Het
Hectd1	A	T	12: 51,759,297	V1852E	probably damaging	Het
Hip1r	A	T	5: 123,995,944	Q256L	probably benign	Het
Hmgxb4	T	C	8: 75,020,262	S405P	probably damaging	Het
Il9r	T	A	11: 32,192,671	H294L	probably benign	Het
Kif12	G	A	4: 63,168,694	T331I	probably damaging	Het
Krtap8-1	A	T	16: 89,487,906	M1K	probably null	Het
Lamc2	A	T	1: 153,139,749	C613S	probably damaging	Het
Lgr4	T	A	2: 110,000,969	N314K	probably benign	Het
Lpcat2	T	C	8: 92,909,266	I432T	probably benign	Het
Mfhas1	T	C	8: 35,588,992	V207A	probably benign	Het
Msh3	T	G	13: 92,349,298	T173P	probably benign	Het
Mup15	T	A	4: 61,438,268	M87L	probably benign	Het
N4bp2	T	C	5: 65,808,022	V1138A	probably benign	Het
Noc2l	T	C	4: 156,241,722	V422A	probably benign	Het
Ocstamp	T	A	2: 165,398,161	K35I	probably benign	Het
Olfr360	T	C	2: 37,068,388	F28L	possibly damaging	Het
Olfr459	T	G	6: 41,772,027	T91P	probably benign	Het
Olfr482	A	G	7: 108,095,135	V145A	probably benign	Het
Olfr692	A	G	7: 105,368,761	H145R	probably benign	Het
Plekhh2	T	A	17: 84,521,788	V29D	probably damaging	Het
Pof1b	A	G	X: 112,644,345	I544T	probably benign	Het
Rad54l2	C	T	9: 106,713,478	R483H	probably damaging	Het
Rapgef6	T	A	11: 54,676,363	D1128E	possibly damaging	Het
Rhbdl2	T	A	4: 123,814,256	I86N	possibly damaging	Het
Rims1	C	A	1: 22,428,489	R68L		Het
Rnf157	A	G	11: 116,362,373	F70L	possibly damaging	Het
Rtp3	C	T	9: 110,985,941	C452Y	unknown	Het
S100a14	A	T	3: 90,527,762	K27*	probably null	Het
Scai	C	T	2: 39,106,936	G282D	possibly damaging	Het
Sclt1	A	T	3: 41,717,760	I132N	probably benign	Het
Serpinf1	T	A	11: 75,417,985	Q2L	possibly damaging	Het
Skor2	T	A	18: 76,860,986	V801E	probably benign	Het
Slc16a10	C	G	10: 40,037,259	E484D	probably benign	Het
Slc1a5	T	A	7: 16,797,538	D489E	probably damaging	Het
Slx4	C	T	16: 3,990,786	R430H	probably benign	Het
Teddm1b	A	T	1: 153,874,933	I163F	probably damaging	Het
Tmem171	A	T	13: 98,692,236	C135*	probably null	Het
Tmem82	C	T	4: 141,614,973	R306H	possibly damaging	Het
Tmem94	T	A	11: 115,790,955		probably null	Het
Trpm2	A	C	10: 77,924,014	L1096R	probably damaging	Het
Trrap	T	A	5: 144,794,049	L780Q	probably damaging	Het
Txlnb	A	G	10: 17,842,984	D521G	probably benign	Het
Usp7	T	C	16: 8,716,526	D59G	probably benign	Het
Vcan	G	A	13: 89,725,591	T48I	probably damaging	Het
Vmn1r45	A	G	6: 89,933,334	L218P	probably damaging	Het
Wdr25	A	T	12: 109,024,996	T370S	probably damaging	Het

Other mutations in Notch3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00161:Notch3	APN	17	32158114	nonsense	probably null
IGL01065:Notch3	APN	17	32146416	nonsense	probably null
IGL01296:Notch3	APN	17	32166757	missense	unknown
IGL01322:Notch3	APN	17	32144471	missense	probably damaging	1.00
IGL01343:Notch3	APN	17	32143436	missense	probably benign	0.10
IGL01358:Notch3	APN	17	32144747	missense	probably damaging	1.00
IGL01600:Notch3	APN	17	32144498	missense	probably damaging	1.00
IGL01622:Notch3	APN	17	32158870	missense	possibly damaging	0.50
IGL01623:Notch3	APN	17	32158870	missense	possibly damaging	0.50
IGL01971:Notch3	APN	17	32124347	missense	probably damaging	1.00
IGL02000:Notch3	APN	17	32122742	missense	probably damaging	0.99
IGL02072:Notch3	APN	17	32147074	nonsense	probably null
IGL02145:Notch3	APN	17	32154741	missense	probably benign	0.01
IGL02256:Notch3	APN	17	32132324	missense	probably damaging	1.00
IGL02366:Notch3	APN	17	32144205	missense	probably benign
IGL02476:Notch3	APN	17	32158638	missense	possibly damaging	0.67
IGL02502:Notch3	APN	17	32158278	nonsense	probably null
IGL02551:Notch3	APN	17	32154731	splice site	probably benign
divide	UTSW	17	32137813	splice site	probably null
Lopressor	UTSW	17	32153884	missense	probably damaging	1.00
marginal	UTSW	17	32164224	missense	probably benign
R1954_Notch3_144	UTSW	17	32166678	missense	probably benign
R4879_Notch3_171	UTSW	17	32147963	missense	probably benign	0.00
PIT4486001:Notch3	UTSW	17	32154763	missense	probably damaging	1.00
R0115:Notch3	UTSW	17	32133462	missense	possibly damaging	0.82
R0201:Notch3	UTSW	17	32156148	splice site	probably benign
R0630:Notch3	UTSW	17	32147472	splice site	probably benign
R1167:Notch3	UTSW	17	32122745	missense	possibly damaging	0.95
R1432:Notch3	UTSW	17	32164224	missense	probably benign
R1567:Notch3	UTSW	17	32158580	missense	possibly damaging	0.77
R1623:Notch3	UTSW	17	32139191	missense	probably benign	0.00
R1663:Notch3	UTSW	17	32156119	missense	probably damaging	1.00
R1668:Notch3	UTSW	17	32158589	missense	probably damaging	0.99
R1789:Notch3	UTSW	17	32158725	missense	probably damaging	1.00
R1813:Notch3	UTSW	17	32143428	missense	probably benign	0.08
R1837:Notch3	UTSW	17	32124322	missense	probably damaging	1.00
R1896:Notch3	UTSW	17	32143428	missense	probably benign	0.08
R1937:Notch3	UTSW	17	32153852	missense	probably benign	0.03
R1954:Notch3	UTSW	17	32166678	missense	probably benign
R2014:Notch3	UTSW	17	32158000	missense	probably benign	0.00
R2058:Notch3	UTSW	17	32143644	missense	probably benign
R2068:Notch3	UTSW	17	32135508	missense	probably benign	0.00
R2097:Notch3	UTSW	17	32122754	missense	probably damaging	1.00
R2112:Notch3	UTSW	17	32144610	missense	probably benign	0.19
R2156:Notch3	UTSW	17	32147844	missense	probably damaging	1.00
R2211:Notch3	UTSW	17	32147978	missense	probably benign	0.00
R2324:Notch3	UTSW	17	32150134	splice site	probably benign
R2432:Notch3	UTSW	17	32153804	missense	probably damaging	1.00
R3117:Notch3	UTSW	17	32158115	missense	probably damaging	1.00
R3236:Notch3	UTSW	17	32158461	missense	probably damaging	0.96
R3409:Notch3	UTSW	17	32150702	missense	possibly damaging	0.67
R3434:Notch3	UTSW	17	32158618	missense	possibly damaging	0.80
R3435:Notch3	UTSW	17	32158618	missense	possibly damaging	0.80
R3438:Notch3	UTSW	17	32153590	missense	probably damaging	1.00
R3926:Notch3	UTSW	17	32153557	missense	possibly damaging	0.92
R4087:Notch3	UTSW	17	32158113	missense	possibly damaging	0.60
R4115:Notch3	UTSW	17	32158433	missense	probably damaging	1.00
R4214:Notch3	UTSW	17	32132207	missense	possibly damaging	0.96
R4234:Notch3	UTSW	17	32141341	missense	probably damaging	0.97
R4242:Notch3	UTSW	17	32143745	missense	possibly damaging	0.74
R4658:Notch3	UTSW	17	32154763	missense	probably damaging	1.00
R4878:Notch3	UTSW	17	32147085	missense	probably damaging	1.00
R4879:Notch3	UTSW	17	32147963	missense	probably benign	0.00
R4885:Notch3	UTSW	17	32141377	missense	probably damaging	0.98
R4924:Notch3	UTSW	17	32144731	missense	probably damaging	1.00
R5084:Notch3	UTSW	17	32157890	critical splice donor site	probably null
R5086:Notch3	UTSW	17	32143334	missense	probably benign	0.13
R5343:Notch3	UTSW	17	32143283	missense	probably benign	0.03
R5389:Notch3	UTSW	17	32139189	missense	probably benign
R5503:Notch3	UTSW	17	32147055	missense	probably benign	0.00
R5698:Notch3	UTSW	17	32157987	missense	probably damaging	1.00
R5824:Notch3	UTSW	17	32153861	missense	possibly damaging	0.92
R5969:Notch3	UTSW	17	32153884	missense	probably damaging	1.00
R6050:Notch3	UTSW	17	32143527	missense	probably benign
R6274:Notch3	UTSW	17	32147290	missense	probably benign
R6276:Notch3	UTSW	17	32154749	missense	probably benign	0.10
R6313:Notch3	UTSW	17	32151154	splice site	probably null
R6316:Notch3	UTSW	17	32137813	splice site	probably null
R6380:Notch3	UTSW	17	32144559	missense	probably damaging	1.00
R6401:Notch3	UTSW	17	32158623	missense	probably benign	0.01
R6502:Notch3	UTSW	17	32158217	missense	probably damaging	1.00
R6741:Notch3	UTSW	17	32143484	missense	probably benign	0.16
R7131:Notch3	UTSW	17	32144217	missense	probably benign
R7140:Notch3	UTSW	17	32156377	missense	possibly damaging	0.84
R7162:Notch3	UTSW	17	32146449	missense	probably damaging	0.98
R7449:Notch3	UTSW	17	32157966	missense	probably damaging	1.00
R7450:Notch3	UTSW	17	32141391	missense	possibly damaging	0.69
R7554:Notch3	UTSW	17	32122371	missense	probably benign	0.03
R7575:Notch3	UTSW	17	32154819	missense	possibly damaging	0.81
R7632:Notch3	UTSW	17	32158506	missense	probably benign
R7633:Notch3	UTSW	17	32158622	missense	probably benign	0.17
R7860:Notch3	UTSW	17	32122773	missense	possibly damaging	0.67
R8052:Notch3	UTSW	17	32146571	missense	probably damaging	1.00
R8250:Notch3	UTSW	17	32132336	missense	probably damaging	1.00
R8296:Notch3	UTSW	17	32122739	missense	probably damaging	1.00
R8306:Notch3	UTSW	17	32158112	missense	probably damaging	0.99
R8458:Notch3	UTSW	17	32156050	missense	probably damaging	1.00
R8539:Notch3	UTSW	17	32156355	missense	possibly damaging	0.92
R8865:Notch3	UTSW	17	32122116	missense	probably benign	0.01
R8925:Notch3	UTSW	17	32153818	missense	probably benign	0.14
R8927:Notch3	UTSW	17	32153818	missense	probably benign	0.14
R9062:Notch3	UTSW	17	32122718	missense	possibly damaging	0.93
R9089:Notch3	UTSW	17	32151547	missense	probably benign	0.00
R9260:Notch3	UTSW	17	32143242	critical splice donor site	probably null
R9289:Notch3	UTSW	17	32158280	missense	probably damaging	1.00
R9294:Notch3	UTSW	17	32143691	missense	probably benign	0.03
T0975:Notch3	UTSW	17	32146417	missense	probably damaging	0.99
Z1088:Notch3	UTSW	17	32158652	missense	possibly damaging	0.94
Z1176:Notch3	UTSW	17	32141516	missense	probably benign	0.12
Z1176:Notch3	UTSW	17	32151370	missense	probably damaging	1.00
Z1177:Notch3	UTSW	17	32166694	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- ACATTCTCGCCTACCAAGGG -3'
(R):5'- GCAGGTAAATTACTGTGAATTCCAGTC -3'

Sequencing Primer
(F):5'- TACCAAGGGTTCCCGTCCAG -3'
(R):5'- TCCAGTCTAGCCAGCGATATGTAG -3'

Posted On

2019-06-26