Incidental Mutation 'R0591:Scin'
ID55994
Institutional Source Beutler Lab
Gene Symbol Scin
Ensembl Gene ENSMUSG00000002565
Gene Namescinderin
Synonymsadseverin
MMRRC Submission 038781-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0591 (G1)
Quality Score176
Status Validated
Chromosome12
Chromosomal Location40059769-40134228 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 40080930 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000077573 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002640] [ENSMUST00000078481]
Predicted Effect probably null
Transcript: ENSMUST00000002640
SMART Domains Protein: ENSMUSP00000002640
Gene: ENSMUSG00000002565

DomainStartEndE-ValueType
GEL 17 114 3.44e-26 SMART
GEL 135 227 3.92e-30 SMART
low complexity region 232 242 N/A INTRINSIC
GEL 252 347 6.56e-32 SMART
GEL 396 489 7.72e-29 SMART
GEL 510 596 2.33e-23 SMART
GEL 615 710 2.07e-29 SMART
Predicted Effect probably null
Transcript: ENSMUST00000078481
SMART Domains Protein: ENSMUSP00000077573
Gene: ENSMUSG00000002565

DomainStartEndE-ValueType
GEL 17 114 3.44e-26 SMART
GEL 135 227 3.92e-30 SMART
low complexity region 232 242 N/A INTRINSIC
GEL 252 347 6.56e-32 SMART
GEL 396 489 7.72e-29 SMART
GEL 510 610 1.09e-28 SMART
Meta Mutation Damage Score 0.9482 question?
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 99.2%
  • 10x: 97.7%
  • 20x: 95.3%
Validation Efficiency 100% (62/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] SCIN is a Ca(2+)-dependent actin-severing and -capping protein (Zunino et al., 2001 [PubMed 11568009]).[supplied by OMIM, May 2010]
PHENOTYPE: Mice homozygous for a conditional allele knocked-out in osteoclasts exhibit impaired osteoclast differentiation and reduced peridontal disease-mediated bone loss. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik G T 3: 138,068,943 E1298* probably null Het
Adam19 T C 11: 46,121,411 probably benign Het
Agt A T 8: 124,556,939 S480R possibly damaging Het
Anapc1 G T 2: 128,619,332 D1769E probably benign Het
Aox4 T C 1: 58,239,102 probably benign Het
Apol9b G A 15: 77,735,630 V209I possibly damaging Het
Appl2 A T 10: 83,624,645 I116K possibly damaging Het
B230118H07Rik A T 2: 101,576,117 D155E probably benign Het
BC051665 A G 13: 60,784,608 probably benign Het
Cactin G T 10: 81,324,003 E89* probably null Het
Carf G T 1: 60,125,914 probably benign Het
Ccdc167 A G 17: 29,705,261 probably benign Het
Ceacam3 G A 7: 17,151,883 probably null Het
Clca4b T A 3: 144,915,592 K574* probably null Het
Crabp1 T A 9: 54,765,603 I64N probably damaging Het
Dgkd T A 1: 87,915,104 I118N probably damaging Het
Dglucy T C 12: 100,859,518 probably benign Het
Dock10 C T 1: 80,541,219 probably benign Het
Ednrb A T 14: 103,823,274 probably null Het
Ercc6 T C 14: 32,558,016 probably benign Het
Gm5538 C A 3: 59,752,129 Y334* probably null Het
Golga3 A C 5: 110,188,743 Q416P probably damaging Het
Gpr12 A G 5: 146,583,635 V159A probably benign Het
Heatr5a A T 12: 51,910,101 probably benign Het
Helz2 A G 2: 181,232,116 I2195T probably damaging Het
Hikeshi A T 7: 89,920,087 N76K possibly damaging Het
Hsd11b1 T C 1: 193,229,676 probably benign Het
Inhba A T 13: 16,026,820 K322N probably damaging Het
Katnal1 A T 5: 148,892,516 F291L probably damaging Het
Kcnj9 T C 1: 172,323,098 E316G probably damaging Het
Lrsam1 A G 2: 32,933,923 probably benign Het
Mcf2l T G 8: 13,018,751 S1075A probably benign Het
Mios T C 6: 8,215,470 V222A possibly damaging Het
Mycbp2 A T 14: 103,196,391 probably benign Het
Nars A T 18: 64,500,567 I544N probably damaging Het
Olfr993 A G 2: 85,414,690 L63P possibly damaging Het
Pbrm1 A G 14: 31,046,430 probably benign Het
Plcb4 A G 2: 135,955,012 probably benign Het
Pnliprp1 A G 19: 58,734,706 D213G probably damaging Het
Psap A G 10: 60,300,855 N538D possibly damaging Het
Ptdss1 A G 13: 66,972,650 probably benign Het
Rap1b G A 10: 117,818,617 probably benign Het
Rhcg T A 7: 79,594,772 probably benign Het
Ryr1 G A 7: 29,104,795 T550I possibly damaging Het
Samm50 G A 15: 84,211,168 G452R probably benign Het
Sesn3 T C 9: 14,308,558 L81S probably damaging Het
Skint6 A C 4: 112,858,169 probably benign Het
Slc30a4 A T 2: 122,685,240 L411H probably damaging Het
Slc44a5 C T 3: 154,234,145 probably benign Het
Slc4a3 C T 1: 75,549,021 A255V probably damaging Het
Slc9b1 A G 3: 135,382,832 N318S possibly damaging Het
Tcp11l2 A T 10: 84,604,594 H287L probably benign Het
Tex10 C T 4: 48,456,800 R637Q probably benign Het
Tnks2 T A 19: 36,872,562 Y605N probably damaging Het
Topbp1 T A 9: 103,349,838 N1490K probably benign Het
Ube4b T G 4: 149,357,577 probably benign Het
Usp4 G A 9: 108,348,029 probably benign Het
Vezf1 A T 11: 88,068,435 probably benign Het
Vmn1r184 A T 7: 26,267,075 D82V probably damaging Het
Other mutations in Scin
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00163:Scin APN 12 40076972 missense probably benign 0.03
IGL01414:Scin APN 12 40124699 missense probably damaging 1.00
IGL01790:Scin APN 12 40063257 missense probably benign 0.02
IGL01807:Scin APN 12 40084289 missense probably damaging 1.00
IGL01946:Scin APN 12 40060491 utr 3 prime probably benign
IGL02040:Scin APN 12 40069453 intron probably benign
IGL02391:Scin APN 12 40077531 missense probably benign 0.05
IGL03221:Scin APN 12 40076974 missense probably benign 0.01
I1329:Scin UTSW 12 40073330 missense probably damaging 0.99
PIT4498001:Scin UTSW 12 40069447 critical splice acceptor site probably null
R0108:Scin UTSW 12 40127987 missense possibly damaging 0.68
R0470:Scin UTSW 12 40073292 splice site probably benign
R0477:Scin UTSW 12 40060516 missense probably damaging 1.00
R0538:Scin UTSW 12 40081771 missense probably damaging 0.98
R0539:Scin UTSW 12 40081766 missense possibly damaging 0.65
R0668:Scin UTSW 12 40080949 missense probably damaging 1.00
R0718:Scin UTSW 12 40079607 missense probably damaging 1.00
R1473:Scin UTSW 12 40077502 missense probably benign
R1566:Scin UTSW 12 40081674 missense probably benign 0.17
R1570:Scin UTSW 12 40084381 splice site probably benign
R1624:Scin UTSW 12 40127930 missense probably benign
R1827:Scin UTSW 12 40068923 missense possibly damaging 0.88
R1836:Scin UTSW 12 40124698 missense probably damaging 1.00
R1985:Scin UTSW 12 40133908 critical splice donor site probably null
R2042:Scin UTSW 12 40077510 missense possibly damaging 0.96
R2061:Scin UTSW 12 40080948 missense probably damaging 1.00
R2147:Scin UTSW 12 40080985 missense probably benign 0.00
R2232:Scin UTSW 12 40068931 missense probably damaging 1.00
R2504:Scin UTSW 12 40081706 missense probably benign 0.02
R4781:Scin UTSW 12 40081764 missense possibly damaging 0.59
R4898:Scin UTSW 12 40104932 missense probably benign
R4914:Scin UTSW 12 40069374 missense possibly damaging 0.79
R4915:Scin UTSW 12 40069374 missense possibly damaging 0.79
R4916:Scin UTSW 12 40069374 missense possibly damaging 0.79
R4917:Scin UTSW 12 40069374 missense possibly damaging 0.79
R4918:Scin UTSW 12 40069374 missense possibly damaging 0.79
R5068:Scin UTSW 12 40124700 missense probably damaging 1.00
R5098:Scin UTSW 12 40077542 nonsense probably null
R5233:Scin UTSW 12 40077559 missense probably benign
R5564:Scin UTSW 12 40124569 missense probably benign
R5677:Scin UTSW 12 40063259 missense probably damaging 1.00
R5967:Scin UTSW 12 40077538 missense probably benign 0.35
R6027:Scin UTSW 12 40077516 missense probably damaging 1.00
R6130:Scin UTSW 12 40069436 missense probably benign 0.01
R6134:Scin UTSW 12 40060579 missense probably damaging 1.00
R6135:Scin UTSW 12 40079808 missense possibly damaging 0.80
R6439:Scin UTSW 12 40068946 missense probably damaging 0.99
R6613:Scin UTSW 12 40079715 missense probably benign 0.04
R7127:Scin UTSW 12 40105072 missense possibly damaging 0.69
R7234:Scin UTSW 12 40080958 nonsense probably null
R7431:Scin UTSW 12 40133922 missense probably damaging 1.00
R7609:Scin UTSW 12 40124589 missense probably damaging 1.00
R7665:Scin UTSW 12 40069415 missense probably damaging 1.00
R7704:Scin UTSW 12 40124688 missense possibly damaging 0.93
X0018:Scin UTSW 12 40069433 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTAGCCCTATACACTGACCTCCAC -3'
(R):5'- GGAATGTTGCCATTCTCCCATTGC -3'

Sequencing Primer
(F):5'- ctctctctctctctctctctctc -3'
(R):5'- gccttacttagattctgagattagac -3'
Posted On2013-07-11