Incidental Mutation 'R7232:Ctps'
ID562537
Institutional Source Beutler Lab
Gene Symbol Ctps
Ensembl Gene ENSMUSG00000028633
Gene Namecytidine 5'-triphosphate synthase
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.948) question?
Stock #R7232 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location120539868-120570276 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 120548124 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Cysteine at position 374 (G374C)
Ref Sequence ENSEMBL: ENSMUSP00000030381 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030381]
Predicted Effect probably damaging
Transcript: ENSMUST00000030381
AA Change: G374C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000030381
Gene: ENSMUSG00000028633
AA Change: G374C

DomainStartEndE-ValueType
Pfam:CTP_synth_N 2 277 2.8e-135 PFAM
Pfam:GATase 309 546 6.7e-55 PFAM
Pfam:Peptidase_C26 378 528 3.8e-10 PFAM
low complexity region 565 578 N/A INTRINSIC
Meta Mutation Damage Score 0.9754 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 99% (80/81)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an enzyme responsible for the catalytic conversion of UTP (uridine triphosphate) to CTP (cytidine triphospate). This reaction is an important step in the biosynthesis of phospholipids and nucleic acids. Activity of this proten is important in the immune system, and loss of function of this gene has been associated with immunodeficiency. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2014]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700020D05Rik A T 19: 5,503,631 S41T possibly damaging Het
4930433I11Rik G A 7: 40,993,179 G91S probably damaging Het
Adam21 T G 12: 81,560,556 N144T probably damaging Het
Adgrg7 T C 16: 56,777,152 probably null Het
Angpt4 T C 2: 151,929,540 S259P possibly damaging Het
Aqr A C 2: 114,105,882 L1320R probably damaging Het
Arhgef10 G A 8: 14,940,323 G266D probably benign Het
Bop1 A G 15: 76,453,346 V693A probably damaging Het
Cd86 CA CAA 16: 36,606,555 probably null Het
Cdc5l A G 17: 45,427,937 probably null Het
Cfap46 C A 7: 139,617,577 R2126L unknown Het
Chek2 T C 5: 110,860,915 V304A probably damaging Het
Cntnap4 T A 8: 112,665,099 probably null Het
Defa27 A T 8: 21,315,609 I22F probably damaging Het
Dnah14 T C 1: 181,757,363 S3220P probably damaging Het
Dopey2 T G 16: 93,760,485 probably null Het
Dpysl5 G A 5: 30,792,298 V471I probably benign Het
Duoxa1 T A 2: 122,305,247 I124F probably damaging Het
Eif4enif1 A G 11: 3,215,678 E85G possibly damaging Het
Eogt T A 6: 97,119,983 I355F probably damaging Het
Epha7 T A 4: 28,951,279 V800E probably damaging Het
Evi5l A G 8: 4,205,906 Q633R possibly damaging Het
Fam170a T C 18: 50,281,661 Y125H probably damaging Het
Fbxo15 T C 18: 84,962,622 Y241H probably damaging Het
Gbe1 T C 16: 70,436,940 I235T possibly damaging Het
Gfra3 C T 18: 34,711,181 R102Q probably damaging Het
Gjd4 C T 18: 9,280,380 G233S probably damaging Het
Gm29106 C T 1: 118,199,561 P328S probably damaging Het
Hgfac G T 5: 35,046,914 R507L probably damaging Het
Jakmip3 A G 7: 139,007,626 K153R probably benign Het
Kcnc1 T A 7: 46,427,959 V395E probably damaging Het
Krt6b T C 15: 101,678,142 D304G probably damaging Het
Ldha T C 7: 46,850,899 Y174H probably benign Het
Lgi4 G A 7: 31,067,351 V268M possibly damaging Het
Lpar3 T G 3: 146,241,306 probably null Het
Lrp3 T C 7: 35,206,052 D103G probably damaging Het
March5 G A 19: 37,217,314 probably null Het
Muc5b A T 7: 141,866,129 H4115L possibly damaging Het
Myh13 G A 11: 67,348,846 D741N probably damaging Het
Naglu A T 11: 101,076,426 I401F probably damaging Het
Ncam2 T A 16: 81,512,871 N416K probably damaging Het
Ncan A G 8: 70,112,088 L292S probably damaging Het
Nkiras1 T C 14: 18,276,732 V7A probably damaging Het
Nlrp4c T A 7: 6,065,709 L203* probably null Het
Olfr714 T A 7: 107,073,855 I9K probably benign Het
Onecut2 T A 18: 64,341,562 W395R probably damaging Het
Pak6 T A 2: 118,693,522 V386E probably damaging Het
Pias2 A G 18: 77,133,235 S396G probably benign Het
Plxna2 T A 1: 194,712,260 L483H probably damaging Het
Prss36 G T 7: 127,935,591 R484S probably benign Het
Ptpn21 A T 12: 98,688,737 V657E probably benign Het
Rassf2 T C 2: 131,996,412 E318G probably damaging Het
Rp1 A C 1: 4,228,601 S623A unknown Het
Runx2 G A 17: 44,814,192 P80L probably damaging Het
Scn11a T A 9: 119,759,916 E1308V probably damaging Het
Serpina3c A T 12: 104,149,512 S258T possibly damaging Het
Slit3 A G 11: 35,610,689 T417A possibly damaging Het
Sostdc1 C A 12: 36,317,311 A162E possibly damaging Het
Sox13 A T 1: 133,384,391 probably null Het
Sox8 G T 17: 25,567,540 S396R probably benign Het
Sult2a3 A T 7: 14,082,760 F164L possibly damaging Het
Susd2 T C 10: 75,639,851 Y438C probably damaging Het
Tas2r106 T G 6: 131,678,847 T14P probably damaging Het
Tcf25 T A 8: 123,401,061 probably null Het
Tenm3 G A 8: 48,235,935 R2206W probably damaging Het
Tep1 A G 14: 50,844,332 L471P unknown Het
Ticrr A T 7: 79,693,742 K1118N probably damaging Het
Tlr5 G A 1: 182,973,499 E123K probably benign Het
Ttn ATATCTCTCCAGAGCCTCCCCTGGAGGAGTGGAGTATCTCTCCAGAGCCTCCCCTGGAGGAGTGGAGTATCTCTCCAGAGCCTCCCCTG ATATCTCTCCAGAGCCTCCCCTGGAGGAGTGGAGTATCTCTCCAGAGCCTCCCCTG 2: 76,915,806 probably benign Het
U2surp A G 9: 95,493,717 V141A probably benign Het
Unc79 T A 12: 103,134,475 S2050T possibly damaging Het
Usp13 A G 3: 32,865,871 D235G probably benign Het
Vcam1 T C 3: 116,125,979 T213A possibly damaging Het
Vmn2r60 T A 7: 42,136,742 I323N possibly damaging Het
Vps13b A G 15: 35,877,557 I2892M probably damaging Het
Wnt5a T A 14: 28,518,372 S160T probably benign Het
Zar1 G A 5: 72,580,951 P36L possibly damaging Het
Zfp773 A T 7: 7,132,985 M204K probably benign Het
Zhx1 T C 15: 58,053,069 T594A probably benign Het
Other mutations in Ctps
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00485:Ctps APN 4 120552944 missense probably damaging 1.00
IGL00919:Ctps APN 4 120567348 missense probably benign 0.03
IGL01510:Ctps APN 4 120558844 missense probably damaging 0.98
IGL01686:Ctps APN 4 120553986 missense probably benign
IGL01897:Ctps APN 4 120567279 missense probably damaging 1.00
IGL02261:Ctps APN 4 120542579 missense possibly damaging 0.53
IGL02797:Ctps APN 4 120562824 missense probably benign 0.03
R0125:Ctps UTSW 4 120561525 splice site probably benign
R1053:Ctps UTSW 4 120543722 splice site probably null
R2087:Ctps UTSW 4 120562815 missense probably benign 0.12
R3736:Ctps UTSW 4 120543746 missense probably benign
R3928:Ctps UTSW 4 120541896 missense probably benign
R3929:Ctps UTSW 4 120541896 missense probably benign
R4193:Ctps UTSW 4 120548138 missense probably damaging 1.00
R4389:Ctps UTSW 4 120558790 missense probably damaging 1.00
R4853:Ctps UTSW 4 120554010 missense probably damaging 1.00
R5045:Ctps UTSW 4 120552878 critical splice donor site probably null
R5074:Ctps UTSW 4 120553973 missense probably damaging 1.00
R5566:Ctps UTSW 4 120554103 splice site probably null
R6235:Ctps UTSW 4 120558806 missense probably benign 0.42
R6828:Ctps UTSW 4 120548138 missense probably damaging 1.00
R7487:Ctps UTSW 4 120558800 missense probably damaging 1.00
X0027:Ctps UTSW 4 120554093 missense probably damaging 1.00
X0062:Ctps UTSW 4 120542617 missense probably benign
Z1176:Ctps UTSW 4 120542743 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ATGCAGCTCTTAAACTTTCCACAC -3'
(R):5'- TGCATCCACAGTCTTCGTG -3'

Sequencing Primer
(F):5'- ACAGACCTTGGCAAGTTGTC -3'
(R):5'- TCTTCGTGACAGTGCAGGC -3'
Posted On2019-06-26