Incidental Mutation 'R7241:Flvcr2'
ID563226
Institutional Source Beutler Lab
Gene Symbol Flvcr2
Ensembl Gene ENSMUSG00000034258
Gene Namefeline leukemia virus subgroup C cellular receptor 2
SynonymsMfsd7c, CCT
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.778) question?
Stock #R7241 (G1)
Quality Score225.009
Status Not validated
Chromosome12
Chromosomal Location85746539-85813585 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 85805239 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 522 (D522E)
Ref Sequence ENSEMBL: ENSMUSP00000035569 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040461]
Predicted Effect probably benign
Transcript: ENSMUST00000040461
AA Change: D522E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000035569
Gene: ENSMUSG00000034258
AA Change: D522E

DomainStartEndE-ValueType
Pfam:MFS_1 113 477 1.7e-30 PFAM
transmembrane domain 488 510 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the major facilitator superfamily. The encoded transmembrane protein is a calcium transporter. Unlike the related protein feline leukemia virus subgroup C receptor 1, the protein encoded by this locus does not bind to feline leukemia virus subgroup C envelope protein. The encoded protein may play a role in development of brain vascular endothelial cells, as mutations at this locus have been associated with proliferative vasculopathy and hydranencephaly-hydrocephaly syndrome. Alternatively spliced transcript variants have been described.[provided by RefSeq, Aug 2010]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik T C 10: 82,287,042 E3378G probably benign Het
Abca14 A G 7: 120,246,961 T612A probably damaging Het
Acacb G A 5: 114,245,100 A2115T possibly damaging Het
Adam32 T C 8: 24,898,494 K398R probably benign Het
Adam9 T A 8: 24,950,986 I824F possibly damaging Het
Ahnak A G 19: 9,009,031 I2560V possibly damaging Het
Ank3 G A 10: 69,706,814 M1I probably null Het
Anks1b T G 10: 90,512,837 I789S probably damaging Het
Ap2b1 T A 11: 83,351,105 N641K probably benign Het
Arhgap33 A G 7: 30,528,721 L412P probably damaging Het
Atp13a3 T A 16: 30,352,277 M317L possibly damaging Het
B4galt5 A G 2: 167,306,697 L167P probably damaging Het
Bace2 T C 16: 97,436,798 I483T possibly damaging Het
C2cd3 A C 7: 100,407,050 K177T Het
Ccr4 T C 9: 114,492,956 T14A probably benign Het
Cep250 A T 2: 155,991,552 H1799L probably benign Het
Cgnl1 T C 9: 71,724,770 Q433R probably benign Het
Copb1 C T 7: 114,237,356 V384M probably damaging Het
Cyp2c50 T A 19: 40,090,568 N118K probably benign Het
Cyp4a32 A G 4: 115,602,302 I78V probably benign Het
Cyth4 A G 15: 78,607,045 K108R probably benign Het
Dnah1 T C 14: 31,264,939 H3632R probably benign Het
Dnah3 T C 7: 119,943,633 I540V probably benign Het
Dock4 A G 12: 40,794,860 Y1174C probably damaging Het
Drd5 A G 5: 38,320,536 T291A probably damaging Het
Fam102a A G 2: 32,558,064 R62G probably benign Het
Fbn1 T C 2: 125,306,495 N2611S possibly damaging Het
Fhod3 A G 18: 25,060,352 E640G probably damaging Het
Fuk A G 8: 110,895,897 I133T probably benign Het
Ganc T A 2: 120,441,529 I556K probably damaging Het
Gjc2 T A 11: 59,177,134 E174V unknown Het
Gm4869 A G 5: 140,462,188 T137A probably damaging Het
Gzmd G A 14: 56,131,342 R32C probably damaging Het
Hltf T A 3: 20,065,392 H200Q probably benign Het
Hrasls5 A G 19: 7,614,581 T121A probably benign Het
Ift88 A G 14: 57,479,997 I559M probably damaging Het
Ighv1-62-1 C A 12: 115,386,702 C115F probably damaging Het
Impdh2 A G 9: 108,563,437 N279S possibly damaging Het
Itpr1 T C 6: 108,517,620 probably null Het
Kansl1l T C 1: 66,801,628 N171S possibly damaging Het
Kif14 T A 1: 136,468,753 C266S probably benign Het
Lrriq1 A C 10: 103,215,973 V306G probably damaging Het
Mast4 G A 13: 103,334,000 R65W possibly damaging Het
Mex3d T C 10: 80,387,257 D55G Het
Mrps27 A T 13: 99,411,280 K233* probably null Het
Myo1f A G 17: 33,579,928 N189S probably damaging Het
Nbn A T 4: 15,991,190 K729N probably benign Het
Olfr1082 C A 2: 86,594,154 V225F possibly damaging Het
Olfr395 T C 11: 73,907,232 S87G probably benign Het
Park2 C A 17: 11,854,861 N355K possibly damaging Het
Pgghg T C 7: 140,945,720 S479P Het
Polr1e A C 4: 45,029,340 H315P probably damaging Het
Pou6f2 A G 13: 18,125,289 V595A Het
Prdm15 T C 16: 97,795,741 D960G possibly damaging Het
Prkcz A T 4: 155,269,059 M460K probably benign Het
Prkd2 G T 7: 16,857,805 R587L probably benign Het
Rabep1 C A 11: 70,939,989 T829N probably damaging Het
Rptn A G 3: 93,395,954 E198G probably benign Het
Ryr2 A T 13: 11,665,913 I3182N possibly damaging Het
Sectm1a T A 11: 121,069,882 I36F possibly damaging Het
Sez6l T C 5: 112,473,480 S243G probably benign Het
Taf2 T A 15: 55,062,141 H235L probably benign Het
Tbc1d7 T C 13: 43,153,017 Q161R probably benign Het
Tfcp2 T C 15: 100,518,587 T271A possibly damaging Het
Thrsp G T 7: 97,417,088 T139K probably damaging Het
Timm10 T A 2: 84,829,989 *91R probably null Het
Tlr11 T A 14: 50,362,141 I528N possibly damaging Het
Tnnt2 T A 1: 135,851,706 L278Q probably damaging Het
Toe1 A T 4: 116,807,518 M1K probably null Het
Trpv5 G A 6: 41,675,308 R148* probably null Het
Ttll13 A C 7: 80,254,163 K280Q probably damaging Het
Ttn A G 2: 76,953,206 V860A unknown Het
Txnip T C 3: 96,559,675 Y222H probably damaging Het
Ubr4 G A 4: 139,443,414 S1600N probably damaging Het
Uhrf1 T C 17: 56,315,193 Y364H probably damaging Het
Unc5a A T 13: 54,991,020 T71S probably damaging Het
Vmn1r123 A T 7: 21,162,612 Y143F possibly damaging Het
Vmn1r180 T A 7: 23,952,466 I18N probably damaging Het
Washc2 A G 6: 116,208,207 M1V probably null Het
Zfp174 C A 16: 3,848,247 H125Q probably benign Het
Zfpl1 T C 19: 6,081,913 H227R possibly damaging Het
Other mutations in Flvcr2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00555:Flvcr2 APN 12 85747323 missense possibly damaging 0.91
IGL01461:Flvcr2 APN 12 85803131 splice site probably benign
IGL02191:Flvcr2 APN 12 85786192 nonsense probably null
IGL02643:Flvcr2 APN 12 85796223 missense possibly damaging 0.96
IGL02933:Flvcr2 APN 12 85803128 splice site probably benign
pulga UTSW 12 85747191 missense possibly damaging 0.94
R1792:Flvcr2 UTSW 12 85747155 nonsense probably null
R1840:Flvcr2 UTSW 12 85803221 missense possibly damaging 0.91
R2402:Flvcr2 UTSW 12 85783003 missense probably benign 0.12
R4120:Flvcr2 UTSW 12 85786129 missense probably benign 0.31
R4900:Flvcr2 UTSW 12 85782982 missense probably damaging 0.98
R5417:Flvcr2 UTSW 12 85747191 missense probably damaging 0.97
R5559:Flvcr2 UTSW 12 85804407 missense probably benign 0.21
R5639:Flvcr2 UTSW 12 85747476 missense probably benign 0.03
R5891:Flvcr2 UTSW 12 85796228 missense possibly damaging 0.74
R6347:Flvcr2 UTSW 12 85747420 missense possibly damaging 0.66
R6349:Flvcr2 UTSW 12 85747200 missense probably benign 0.30
R7082:Flvcr2 UTSW 12 85746954 missense probably benign 0.03
R7179:Flvcr2 UTSW 12 85747191 missense possibly damaging 0.94
R7459:Flvcr2 UTSW 12 85747057 missense probably benign 0.14
R8030:Flvcr2 UTSW 12 85798538 missense probably damaging 0.97
R8384:Flvcr2 UTSW 12 85796193 missense possibly damaging 0.95
RF013:Flvcr2 UTSW 12 85747186 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TTCTGCGTCTCAAGCACAGC -3'
(R):5'- CCACTGAGGAAATTCTTTGGATGTC -3'

Sequencing Primer
(F):5'- ACCAGTTCTATTCTGATGTTGTGAC -3'
(R):5'- ATGTCATGTTTATGAGAGGTGAGC -3'
Posted On2019-06-26