Mutagenetix > Incidental Mutations

Incidental Mutation 'R7294:Specc1'

566632

Institutional Source

Beutler Lab

Gene Symbol

Specc1

Ensembl Gene

ENSMUSG00000042331

Gene Name

sperm antigen with calponin homology and coiled-coil domains 1

Synonyms

Cytsb

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.157) question?

Stock #

R7294 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

61956763-62223013 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 62118337 bp

Zygosity

Heterozygous

Amino Acid Change

Serine to Arginine at position 226 (S226R)

Ref Sequence

ENSEMBL: ENSMUSP00000144300 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000049836] [ENSMUST00000092415] [ENSMUST00000108709] [ENSMUST00000201015] [ENSMUST00000201364] [ENSMUST00000201624] [ENSMUST00000201671] [ENSMUST00000201723] [ENSMUST00000202178] [ENSMUST00000202179] [ENSMUST00000202389] [ENSMUST00000202744] [ENSMUST00000202905]

Predicted Effect

probably benign
Transcript: ENSMUST00000049836
AA Change: S306R

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)

SMART Domains

Protein: ENSMUSP00000063102
Gene: ENSMUSG00000042331
AA Change: S306R

Domain	Start	End	E-Value	Type
low complexity region	26	40	N/A	INTRINSIC
low complexity region	123	143	N/A	INTRINSIC
coiled coil region	159	196	N/A	INTRINSIC
coiled coil region	224	259	N/A	INTRINSIC
low complexity region	311	316	N/A	INTRINSIC
coiled coil region	362	454	N/A	INTRINSIC
coiled coil region	479	520	N/A	INTRINSIC
coiled coil region	575	773	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000092415
AA Change: S226R

PolyPhen 2 Score 0.019 (Sensitivity: 0.95; Specificity: 0.80)

SMART Domains

Protein: ENSMUSP00000090071
Gene: ENSMUSG00000042331
AA Change: S226R

Domain	Start	End	E-Value	Type
low complexity region	43	63	N/A	INTRINSIC
coiled coil region	79	116	N/A	INTRINSIC
coiled coil region	144	179	N/A	INTRINSIC
low complexity region	231	236	N/A	INTRINSIC
coiled coil region	282	374	N/A	INTRINSIC
coiled coil region	399	440	N/A	INTRINSIC
coiled coil region	495	693	N/A	INTRINSIC
low complexity region	805	816	N/A	INTRINSIC
low complexity region	832	844	N/A	INTRINSIC
CH	883	981	2.69e-16	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000108709
AA Change: S306R

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)

SMART Domains

Protein: ENSMUSP00000104349
Gene: ENSMUSG00000042331
AA Change: S306R

Domain	Start	End	E-Value	Type
low complexity region	26	40	N/A	INTRINSIC
low complexity region	123	143	N/A	INTRINSIC
coiled coil region	159	196	N/A	INTRINSIC
coiled coil region	224	259	N/A	INTRINSIC
low complexity region	311	316	N/A	INTRINSIC
coiled coil region	362	454	N/A	INTRINSIC
coiled coil region	479	520	N/A	INTRINSIC
coiled coil region	575	773	N/A	INTRINSIC
low complexity region	885	896	N/A	INTRINSIC
low complexity region	912	924	N/A	INTRINSIC
CH	963	1061	2.69e-16	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000201015

SMART Domains

Protein: ENSMUSP00000144174
Gene: ENSMUSG00000042331

Domain	Start	End	E-Value	Type
coiled coil region	23	113	N/A	INTRINSIC
low complexity region	225	236	N/A	INTRINSIC
low complexity region	252	264	N/A	INTRINSIC
CH	303	401	1.4e-18	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000201364
AA Change: S306R

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)

SMART Domains

Protein: ENSMUSP00000143853
Gene: ENSMUSG00000042331
AA Change: S306R

Domain	Start	End	E-Value	Type
low complexity region	26	40	N/A	INTRINSIC
low complexity region	123	143	N/A	INTRINSIC
coiled coil region	159	196	N/A	INTRINSIC
coiled coil region	224	259	N/A	INTRINSIC
low complexity region	311	316	N/A	INTRINSIC
coiled coil region	362	454	N/A	INTRINSIC
coiled coil region	479	520	N/A	INTRINSIC
coiled coil region	575	773	N/A	INTRINSIC
low complexity region	876	887	N/A	INTRINSIC
low complexity region	903	915	N/A	INTRINSIC
CH	954	1052	2.69e-16	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000201624
AA Change: S306R

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)

SMART Domains

Protein: ENSMUSP00000144659
Gene: ENSMUSG00000042331
AA Change: S306R

Domain	Start	End	E-Value	Type
low complexity region	26	40	N/A	INTRINSIC
low complexity region	123	143	N/A	INTRINSIC
coiled coil region	159	196	N/A	INTRINSIC
coiled coil region	224	259	N/A	INTRINSIC
low complexity region	311	316	N/A	INTRINSIC
coiled coil region	362	454	N/A	INTRINSIC
coiled coil region	479	520	N/A	INTRINSIC
coiled coil region	575	773	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000201671
AA Change: S306R

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)

SMART Domains

Protein: ENSMUSP00000144030
Gene: ENSMUSG00000042331
AA Change: S306R

Domain	Start	End	E-Value	Type
low complexity region	26	40	N/A	INTRINSIC
low complexity region	123	143	N/A	INTRINSIC
coiled coil region	159	196	N/A	INTRINSIC
coiled coil region	224	259	N/A	INTRINSIC
low complexity region	311	316	N/A	INTRINSIC
coiled coil region	362	454	N/A	INTRINSIC
coiled coil region	479	520	N/A	INTRINSIC
coiled coil region	575	773	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000201723
AA Change: S226R

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)

SMART Domains

Protein: ENSMUSP00000144542
Gene: ENSMUSG00000042331
AA Change: S226R

Domain	Start	End	E-Value	Type
low complexity region	43	63	N/A	INTRINSIC
coiled coil region	79	116	N/A	INTRINSIC
coiled coil region	144	179	N/A	INTRINSIC
low complexity region	231	236	N/A	INTRINSIC
coiled coil region	282	374	N/A	INTRINSIC
coiled coil region	399	440	N/A	INTRINSIC
coiled coil region	495	693	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000202178
AA Change: S306R

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)

SMART Domains

Protein: ENSMUSP00000144161
Gene: ENSMUSG00000042331
AA Change: S306R

Domain	Start	End	E-Value	Type
low complexity region	26	40	N/A	INTRINSIC
low complexity region	123	143	N/A	INTRINSIC
coiled coil region	159	196	N/A	INTRINSIC
coiled coil region	224	259	N/A	INTRINSIC
low complexity region	311	316	N/A	INTRINSIC
coiled coil region	362	454	N/A	INTRINSIC
coiled coil region	479	520	N/A	INTRINSIC
coiled coil region	575	773	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000202179
AA Change: S226R

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)

SMART Domains

Protein: ENSMUSP00000144300
Gene: ENSMUSG00000042331
AA Change: S226R

Domain	Start	End	E-Value	Type
low complexity region	43	63	N/A	INTRINSIC
coiled coil region	79	116	N/A	INTRINSIC
coiled coil region	144	179	N/A	INTRINSIC
low complexity region	231	236	N/A	INTRINSIC
coiled coil region	282	374	N/A	INTRINSIC
coiled coil region	399	440	N/A	INTRINSIC
coiled coil region	495	693	N/A	INTRINSIC
low complexity region	796	807	N/A	INTRINSIC
low complexity region	823	835	N/A	INTRINSIC
CH	874	972	2.69e-16	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000202389
AA Change: S306R

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)

SMART Domains

Protein: ENSMUSP00000144055
Gene: ENSMUSG00000042331
AA Change: S306R

Domain	Start	End	E-Value	Type
low complexity region	26	40	N/A	INTRINSIC
low complexity region	123	143	N/A	INTRINSIC
coiled coil region	159	196	N/A	INTRINSIC
coiled coil region	224	259	N/A	INTRINSIC
low complexity region	311	316	N/A	INTRINSIC
coiled coil region	362	454	N/A	INTRINSIC
coiled coil region	479	520	N/A	INTRINSIC
coiled coil region	575	773	N/A	INTRINSIC
low complexity region	885	896	N/A	INTRINSIC
low complexity region	912	924	N/A	INTRINSIC
CH	963	1061	2.69e-16	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000202744

SMART Domains

Protein: ENSMUSP00000144483
Gene: ENSMUSG00000042331

Domain	Start	End	E-Value	Type
coiled coil region	23	113	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000202905
AA Change: S306R

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)

SMART Domains

Protein: ENSMUSP00000144311
Gene: ENSMUSG00000042331
AA Change: S306R

Domain	Start	End	E-Value	Type
low complexity region	26	40	N/A	INTRINSIC
low complexity region	123	143	N/A	INTRINSIC
coiled coil region	159	196	N/A	INTRINSIC
coiled coil region	224	259	N/A	INTRINSIC
low complexity region	311	316	N/A	INTRINSIC
coiled coil region	362	454	N/A	INTRINSIC
coiled coil region	479	520	N/A	INTRINSIC
coiled coil region	575	773	N/A	INTRINSIC
low complexity region	885	896	N/A	INTRINSIC
low complexity region	912	924	N/A	INTRINSIC
CH	963	1061	2.69e-16	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.0%

Validation Efficiency

94% (49/52)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the cytospin-A family. It is localized in the nucleus, and highly expressed in testis and some cancer cell lines. A chromosomal translocation involving this gene and platelet-derived growth factor receptor, beta gene (PDGFRB) may be a cause of juvenile myelomonocytic leukemia. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Aug 2011]

Allele List at MGI

Other mutations in this stock

Total: 52 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A2m	T	A	6: 121,673,582	Y1216*	probably null	Het
Abca17	G	A	17: 24,321,009	T415M	not run	Het
Adam1a	G	T	5: 121,520,005	C408*	probably null	Het
Adamts9	G	A	6: 92,894,289	T603M	probably damaging	Het
Amdhd1	T	C	10: 93,534,439	E179G	probably benign	Het
Bcan	T	C	3: 87,995,524	T316A	possibly damaging	Het
Bpifb9a	C	T	2: 154,267,696	T504M	probably damaging	Het
C5ar1	T	C	7: 16,249,025	I23M	probably benign	Het
Cd109	A	T	9: 78,712,635	E1386D	probably damaging	Het
Cdcp1	C	T	9: 123,177,921	C587Y	probably benign	Het
Cdh22	A	C	2: 165,142,093	V413G	possibly damaging	Het
Cfap44	A	G	16: 44,404,893		probably benign	Het
Col2a1	A	G	15: 97,987,287		probably null	Het
Col6a3	A	T	1: 90,828,283	Y95N	probably damaging	Het
Dusp13	A	G	14: 21,733,714	S178P	possibly damaging	Het
Fhod3	A	G	18: 25,132,980	E1575G	probably damaging	Het
Gfpt2	C	T	11: 49,818,608	R209*	probably null	Het
Gm12169	T	A	11: 46,535,612	I182K	probably benign	Het
Heg1	T	C	16: 33,726,489	S573P	probably damaging	Het
Hinfp	A	G	9: 44,299,270	C152R	probably damaging	Het
Hmgcs2	C	T	3: 98,290,895	T38I	probably benign	Het
Jakmip1	T	C	5: 37,117,460	F441L	possibly damaging	Het
Kcnj5	A	C	9: 32,322,749	L90R	probably damaging	Het
Kpna4	A	C	3: 69,092,623		probably null	Het
Krt15	T	A	11: 100,132,022	I456F	possibly damaging	Het
Leprotl1	A	T	8: 34,138,852		probably null	Het
Muc4	A	T	16: 32,756,461	T42S	possibly damaging	Het
Nat6	T	G	9: 107,582,983	F26V	possibly damaging	Het
Nr1h5	T	C	3: 102,945,262	T419A	probably benign	Het
Nutm1	G	A	2: 112,250,056	R505C	probably damaging	Het
Olfr1259	A	C	2: 89,943,724	Y130*	probably null	Het
Olfr549	T	A	7: 102,554,953	I223N	probably damaging	Het
Pax6	T	A	2: 105,684,901	C66*	probably null	Het
Pde10a	A	T	17: 8,757,021	N53Y	probably benign	Het
Pdgfra	A	G	5: 75,181,651	N711S	probably benign	Het
Rimkla	A	T	4: 119,468,466	S249T	probably damaging	Het
Rsf1	CGGCGGCGG	CGGCGGCGGGGGCGGCGG	7: 97,579,920		probably benign	Het
Scn3a	A	G	2: 65,472,341	S1254P	probably damaging	Het
Slc26a1	G	T	5: 108,673,832	R80S	possibly damaging	Het
Slc2a4	T	C	11: 69,945,399	D262G	probably benign	Het
Srsf4	A	G	4: 131,900,461	S289G	unknown	Het
Stil	T	C	4: 115,007,283	V127A	probably benign	Het
Syne1	A	T	10: 5,097,483		probably null	Het
Tbc1d22a	T	A	15: 86,311,835	Y336N	possibly damaging	Het
Tbc1d8	C	T	1: 39,406,762	G116E	probably damaging	Het
Thrb	A	G	14: 17,826,963		probably benign	Het
Tln1	G	T	4: 43,534,399	H2253Q	probably benign	Het
Tmem131	A	C	1: 36,854,847	N158K	possibly damaging	Het
Toporsl	A	C	4: 52,611,903	T599P	probably benign	Het
Tpr	C	T	1: 150,403,887	R256C	probably damaging	Het
Triobp	C	T	15: 78,973,976	A1259V	probably damaging	Het
Zfp40	A	G	17: 23,176,437	I392T	possibly damaging	Het

Other mutations in Specc1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00156:Specc1	APN	11	62118009	missense	probably benign	0.02
IGL01953:Specc1	APN	11	62118296	missense	probably benign	0.40
IGL02244:Specc1	APN	11	62128368	missense	probably benign	0.41
IGL02257:Specc1	APN	11	62118417	missense	probably damaging	1.00
IGL02512:Specc1	APN	11	62118389	missense	probably damaging	1.00
IGL03147:Specc1	UTSW	11	62118282	missense	probably benign
R0039:Specc1	UTSW	11	62029369	missense	probably damaging	0.97
R0114:Specc1	UTSW	11	62146313	missense	possibly damaging	0.92
R0635:Specc1	UTSW	11	62118903	missense	probably damaging	1.00
R1514:Specc1	UTSW	11	62156532	missense	probably damaging	1.00
R1604:Specc1	UTSW	11	62043057	missense	probably damaging	1.00
R1717:Specc1	UTSW	11	62128392	missense	possibly damaging	0.88
R1719:Specc1	UTSW	11	62128392	missense	possibly damaging	0.88
R1739:Specc1	UTSW	11	62118818	nonsense	probably null
R1757:Specc1	UTSW	11	62119284	critical splice donor site	probably null
R1990:Specc1	UTSW	11	62029294	missense	possibly damaging	0.87
R1991:Specc1	UTSW	11	62029294	missense	possibly damaging	0.87
R2063:Specc1	UTSW	11	62118296	missense	probably benign	0.01
R2071:Specc1	UTSW	11	62117875	missense	probably damaging	0.98
R2245:Specc1	UTSW	11	62131887	missense	probably damaging	1.00
R3415:Specc1	UTSW	11	62118419	missense	probably benign	0.29
R3831:Specc1	UTSW	11	62117967	missense	probably damaging	1.00
R3890:Specc1	UTSW	11	62151913	missense	probably benign	0.00
R3891:Specc1	UTSW	11	62151913	missense	probably benign	0.00
R4367:Specc1	UTSW	11	62118530	missense	probably damaging	1.00
R4489:Specc1	UTSW	11	62151827	splice site	probably null
R4580:Specc1	UTSW	11	62219331	missense	probably damaging	1.00
R4852:Specc1	UTSW	11	62211684	missense	probably damaging	1.00
R4930:Specc1	UTSW	11	62118958	missense	possibly damaging	0.93
R5016:Specc1	UTSW	11	62118957	missense	possibly damaging	0.92
R5416:Specc1	UTSW	11	62118909	missense	probably benign	0.00
R5650:Specc1	UTSW	11	62117967	missense	probably damaging	1.00
R6158:Specc1	UTSW	11	62118124	missense	probably damaging	0.99
R6329:Specc1	UTSW	11	62156553	missense	probably damaging	1.00
R6374:Specc1	UTSW	11	62156592	missense	possibly damaging	0.93
R6395:Specc1	UTSW	11	62132338	missense	probably damaging	1.00
R6653:Specc1	UTSW	11	62146418	missense	probably damaging	0.99
R6893:Specc1	UTSW	11	62132453	missense	probably benign
R6898:Specc1	UTSW	11	62118336	missense	probably benign
R7054:Specc1	UTSW	11	62117778	missense	probably damaging	0.96
R7376:Specc1	UTSW	11	62118252	missense	probably benign	0.06
R7560:Specc1	UTSW	11	62128409	critical splice donor site	probably null
R7605:Specc1	UTSW	11	62211680	missense	possibly damaging	0.91
R7621:Specc1	UTSW	11	62128384	missense	possibly damaging	0.96
R7804:Specc1	UTSW	11	62205397	missense	probably damaging	0.99
R7900:Specc1	UTSW	11	62219361	missense	probably damaging	1.00
R8310:Specc1	UTSW	11	62132345	missense	probably damaging	1.00
R8319:Specc1	UTSW	11	62118675	missense	possibly damaging	0.77
Z1177:Specc1	UTSW	11	62118767	missense	possibly damaging	0.86
Z1177:Specc1	UTSW	11	62205423	missense	possibly damaging	0.84

Predicted Primers

PCR Primer
(F):5'- AGAGCTTGCTGACCTAGAGG -3'
(R):5'- TGCCAAGGACAGCTCACTTG -3'

Sequencing Primer
(F):5'- CTTGCTGACCTAGAGGAAGAAAAC -3'
(R):5'- AGGACAGCTCACTTGCATTG -3'

Posted On

2019-06-26