Mutagenetix > Incidental Mutations

Incidental Mutation 'R7900:Specc1'

609952

Institutional Source

Beutler Lab

Gene Symbol

Specc1

Ensembl Gene

ENSMUSG00000042331

Gene Name

sperm antigen with calponin homology and coiled-coil domains 1

Synonyms

Cytsb

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.157) question?

Stock #

R7900 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

61956763-62223013 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 62219361 bp

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Cysteine at position 975 (Y975C)

Ref Sequence

ENSEMBL: ENSMUSP00000144300 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000092415] [ENSMUST00000108709] [ENSMUST00000201015] [ENSMUST00000201364] [ENSMUST00000202179] [ENSMUST00000202389] [ENSMUST00000202905]

Predicted Effect

probably damaging
Transcript: ENSMUST00000092415
AA Change: Y984C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000090071
Gene: ENSMUSG00000042331
AA Change: Y984C

Domain	Start	End	E-Value	Type
low complexity region	43	63	N/A	INTRINSIC
coiled coil region	79	116	N/A	INTRINSIC
coiled coil region	144	179	N/A	INTRINSIC
low complexity region	231	236	N/A	INTRINSIC
coiled coil region	282	374	N/A	INTRINSIC
coiled coil region	399	440	N/A	INTRINSIC
coiled coil region	495	693	N/A	INTRINSIC
low complexity region	805	816	N/A	INTRINSIC
low complexity region	832	844	N/A	INTRINSIC
CH	883	981	2.69e-16	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000108709
AA Change: Y1064C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000104349
Gene: ENSMUSG00000042331
AA Change: Y1064C

Domain	Start	End	E-Value	Type
low complexity region	26	40	N/A	INTRINSIC
low complexity region	123	143	N/A	INTRINSIC
coiled coil region	159	196	N/A	INTRINSIC
coiled coil region	224	259	N/A	INTRINSIC
low complexity region	311	316	N/A	INTRINSIC
coiled coil region	362	454	N/A	INTRINSIC
coiled coil region	479	520	N/A	INTRINSIC
coiled coil region	575	773	N/A	INTRINSIC
low complexity region	885	896	N/A	INTRINSIC
low complexity region	912	924	N/A	INTRINSIC
CH	963	1061	2.69e-16	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000201015
AA Change: Y404C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000144174
Gene: ENSMUSG00000042331
AA Change: Y404C

Domain	Start	End	E-Value	Type
coiled coil region	23	113	N/A	INTRINSIC
low complexity region	225	236	N/A	INTRINSIC
low complexity region	252	264	N/A	INTRINSIC
CH	303	401	1.4e-18	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000201364
AA Change: Y1055C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000143853
Gene: ENSMUSG00000042331
AA Change: Y1055C

Domain	Start	End	E-Value	Type
low complexity region	26	40	N/A	INTRINSIC
low complexity region	123	143	N/A	INTRINSIC
coiled coil region	159	196	N/A	INTRINSIC
coiled coil region	224	259	N/A	INTRINSIC
low complexity region	311	316	N/A	INTRINSIC
coiled coil region	362	454	N/A	INTRINSIC
coiled coil region	479	520	N/A	INTRINSIC
coiled coil region	575	773	N/A	INTRINSIC
low complexity region	876	887	N/A	INTRINSIC
low complexity region	903	915	N/A	INTRINSIC
CH	954	1052	2.69e-16	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000202179
AA Change: Y975C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000144300
Gene: ENSMUSG00000042331
AA Change: Y975C

Domain	Start	End	E-Value	Type
low complexity region	43	63	N/A	INTRINSIC
coiled coil region	79	116	N/A	INTRINSIC
coiled coil region	144	179	N/A	INTRINSIC
low complexity region	231	236	N/A	INTRINSIC
coiled coil region	282	374	N/A	INTRINSIC
coiled coil region	399	440	N/A	INTRINSIC
coiled coil region	495	693	N/A	INTRINSIC
low complexity region	796	807	N/A	INTRINSIC
low complexity region	823	835	N/A	INTRINSIC
CH	874	972	2.69e-16	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000202389
AA Change: Y1064C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000144055
Gene: ENSMUSG00000042331
AA Change: Y1064C

Domain	Start	End	E-Value	Type
low complexity region	26	40	N/A	INTRINSIC
low complexity region	123	143	N/A	INTRINSIC
coiled coil region	159	196	N/A	INTRINSIC
coiled coil region	224	259	N/A	INTRINSIC
low complexity region	311	316	N/A	INTRINSIC
coiled coil region	362	454	N/A	INTRINSIC
coiled coil region	479	520	N/A	INTRINSIC
coiled coil region	575	773	N/A	INTRINSIC
low complexity region	885	896	N/A	INTRINSIC
low complexity region	912	924	N/A	INTRINSIC
CH	963	1061	2.69e-16	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000202905
AA Change: Y1064C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000144311
Gene: ENSMUSG00000042331
AA Change: Y1064C

Domain	Start	End	E-Value	Type
low complexity region	26	40	N/A	INTRINSIC
low complexity region	123	143	N/A	INTRINSIC
coiled coil region	159	196	N/A	INTRINSIC
coiled coil region	224	259	N/A	INTRINSIC
low complexity region	311	316	N/A	INTRINSIC
coiled coil region	362	454	N/A	INTRINSIC
coiled coil region	479	520	N/A	INTRINSIC
coiled coil region	575	773	N/A	INTRINSIC
low complexity region	885	896	N/A	INTRINSIC
low complexity region	912	924	N/A	INTRINSIC
CH	963	1061	2.69e-16	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.5%
20x: 98.5%

Validation Efficiency

100% (50/50)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the cytospin-A family. It is localized in the nucleus, and highly expressed in testis and some cancer cell lines. A chromosomal translocation involving this gene and platelet-derived growth factor receptor, beta gene (PDGFRB) may be a cause of juvenile myelomonocytic leukemia. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Aug 2011]

Allele List at MGI

Other mutations in this stock

Total: 50 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A530084C06Rik	G	T	13: 31,558,995	R92S	unknown	Het
Adamtsl5	A	G	10: 80,341,901	F309S	probably damaging	Het
Ankle1	C	T	8: 71,407,417	T213I	probably damaging	Het
C4b	A	G	17: 34,739,777	S528P	probably benign	Het
Camk2a	A	G	18: 60,957,366	Y222C	probably damaging	Het
Cnst	A	G	1: 179,622,888	D639G	probably damaging	Het
Ctbp2	A	C	7: 133,014,599	S202R	probably benign	Het
Cwf19l2	G	T	9: 3,460,107	L798F	probably damaging	Het
Cyp11a1	T	A	9: 58,016,384	V124E	possibly damaging	Het
Ddx3y	C	T	Y: 1,266,594		probably null	Het
Dlst	G	T	12: 85,130,518	R346L	probably benign	Het
Dnah2	A	G	11: 69,518,428	S375P	probably damaging	Het
Dnm3	T	A	1: 162,355,371	Y125F	probably benign	Het
Dock9	C	T	14: 121,546,079	A2011T	possibly damaging	Het
Efr3a	T	A	15: 65,848,135		probably null	Het
Egln1	A	T	8: 124,914,140	I319N	possibly damaging	Het
Gata3	T	A	2: 9,858,650	N351I	probably damaging	Het
Gjc1	T	C	11: 102,800,094	N361S	probably benign	Het
Gpcpd1	T	C	2: 132,534,739	T546A	probably damaging	Het
Gpihbp1	T	C	15: 75,597,942	F169L	probably benign	Het
Gpnmb	A	T	6: 49,050,466	I375L	possibly damaging	Het
Itpka	A	T	2: 119,750,513	T381S	probably benign	Het
Lhx4	T	C	1: 155,741,963		probably benign	Het
Lrguk	T	C	6: 34,129,194	L718P	probably benign	Het
Mmp1a	TG	TGG	9: 7,465,083		probably null	Het
Nr1d1	T	A	11: 98,769,711	T477S	probably benign	Het
Nxnl1	A	T	8: 71,566,526	D18E	probably damaging	Het
Olfr1434	T	A	19: 12,283,341	C98S	probably damaging	Het
Olfr620	T	C	7: 103,611,693	Y220C	possibly damaging	Het
Onecut2	G	T	18: 64,341,587	R403L	probably damaging	Het
Pla2r1	T	C	2: 60,428,514	T1177A	possibly damaging	Het
Prkd2	T	C	7: 16,853,344	V405A	probably benign	Het
Ranbp1	T	C	16: 18,245,297	T72A	probably damaging	Het
Retnla	A	C	16: 48,843,614	R90S	probably benign	Het
Sec31b	A	T	19: 44,526,230	I385N	probably damaging	Het
Slc6a19	C	T	13: 73,700,464	R57H	probably damaging	Het
Smurf1	T	C	5: 144,899,373	D110G	probably damaging	Het
Tas2r136	T	A	6: 132,777,636	N176I	possibly damaging	Het
Tecrl	A	C	5: 83,279,341	V320G	probably benign	Het
Tmem245	A	G	4: 56,924,973		probably null	Het
Tpd52l1	T	A	10: 31,338,182		probably null	Het
Trbv2	A	G	6: 41,047,974	Y108C	probably damaging	Het
Trpm7	T	C	2: 126,797,498	M1689V	probably benign	Het
Usp24	A	G	4: 106,409,400	Y1855C	probably damaging	Het
Usp9y	A	T	Y: 1,384,354	S721R	possibly damaging	Het
Vwf	G	A	6: 125,628,476		probably null	Het
Washc4	T	A	10: 83,573,773		probably null	Het
Yeats4	G	A	10: 117,220,559	H71Y	possibly damaging	Het
Zbtb38	A	C	9: 96,688,936	L32V	probably damaging	Het
Zfy1	T	C	Y: 725,519	T749A	possibly damaging	Het

Other mutations in Specc1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00156:Specc1	APN	11	62118009	missense	probably benign	0.02
IGL01953:Specc1	APN	11	62118296	missense	probably benign	0.40
IGL02244:Specc1	APN	11	62128368	missense	probably benign	0.41
IGL02257:Specc1	APN	11	62118417	missense	probably damaging	1.00
IGL02512:Specc1	APN	11	62118389	missense	probably damaging	1.00
IGL03147:Specc1	UTSW	11	62118282	missense	probably benign
R0039:Specc1	UTSW	11	62029369	missense	probably damaging	0.97
R0114:Specc1	UTSW	11	62146313	missense	possibly damaging	0.92
R0635:Specc1	UTSW	11	62118903	missense	probably damaging	1.00
R1514:Specc1	UTSW	11	62156532	missense	probably damaging	1.00
R1604:Specc1	UTSW	11	62043057	missense	probably damaging	1.00
R1717:Specc1	UTSW	11	62128392	missense	possibly damaging	0.88
R1719:Specc1	UTSW	11	62128392	missense	possibly damaging	0.88
R1739:Specc1	UTSW	11	62118818	nonsense	probably null
R1757:Specc1	UTSW	11	62119284	critical splice donor site	probably null
R1990:Specc1	UTSW	11	62029294	missense	possibly damaging	0.87
R1991:Specc1	UTSW	11	62029294	missense	possibly damaging	0.87
R2063:Specc1	UTSW	11	62118296	missense	probably benign	0.01
R2071:Specc1	UTSW	11	62117875	missense	probably damaging	0.98
R2245:Specc1	UTSW	11	62131887	missense	probably damaging	1.00
R3415:Specc1	UTSW	11	62118419	missense	probably benign	0.29
R3831:Specc1	UTSW	11	62117967	missense	probably damaging	1.00
R3890:Specc1	UTSW	11	62151913	missense	probably benign	0.00
R3891:Specc1	UTSW	11	62151913	missense	probably benign	0.00
R4367:Specc1	UTSW	11	62118530	missense	probably damaging	1.00
R4489:Specc1	UTSW	11	62151827	splice site	probably null
R4580:Specc1	UTSW	11	62219331	missense	probably damaging	1.00
R4852:Specc1	UTSW	11	62211684	missense	probably damaging	1.00
R4930:Specc1	UTSW	11	62118958	missense	possibly damaging	0.93
R5016:Specc1	UTSW	11	62118957	missense	possibly damaging	0.92
R5416:Specc1	UTSW	11	62118909	missense	probably benign	0.00
R5650:Specc1	UTSW	11	62117967	missense	probably damaging	1.00
R6158:Specc1	UTSW	11	62118124	missense	probably damaging	0.99
R6329:Specc1	UTSW	11	62156553	missense	probably damaging	1.00
R6374:Specc1	UTSW	11	62156592	missense	possibly damaging	0.93
R6395:Specc1	UTSW	11	62132338	missense	probably damaging	1.00
R6653:Specc1	UTSW	11	62146418	missense	probably damaging	0.99
R6893:Specc1	UTSW	11	62132453	missense	probably benign
R6898:Specc1	UTSW	11	62118336	missense	probably benign
R7054:Specc1	UTSW	11	62117778	missense	probably damaging	0.96
R7294:Specc1	UTSW	11	62118337	missense	probably benign	0.01
R7376:Specc1	UTSW	11	62118252	missense	probably benign	0.06
R7560:Specc1	UTSW	11	62128409	critical splice donor site	probably null
R7605:Specc1	UTSW	11	62211680	missense	possibly damaging	0.91
R7621:Specc1	UTSW	11	62128384	missense	possibly damaging	0.96
R7804:Specc1	UTSW	11	62205397	missense	probably damaging	0.99
R8310:Specc1	UTSW	11	62132345	missense	probably damaging	1.00
R8319:Specc1	UTSW	11	62118675	missense	possibly damaging	0.77
Z1177:Specc1	UTSW	11	62118767	missense	possibly damaging	0.86
Z1177:Specc1	UTSW	11	62205423	missense	possibly damaging	0.84

Predicted Primers

PCR Primer
(F):5'- AGAGGGTTTCTGGTCCGTAC -3'
(R):5'- GGTTGCTGAACATAGGCTCCAG -3'

Sequencing Primer
(F):5'- GTACCAACCCTGACCTGTATCAG -3'
(R):5'- ACATAGGCTCCAGGCATGTTG -3'

Posted On

2019-12-20