Incidental Mutation 'R0638:Cacna1i'
ID 56838
Institutional Source Beutler Lab
Gene Symbol Cacna1i
Ensembl Gene ENSMUSG00000022416
Gene Name calcium channel, voltage-dependent, alpha 1I subunit
MMRRC Submission 038827-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R0638 (G1)
Quality Score 225
Status Validated
Chromosome 15
Chromosomal Location 80287238-80398279 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 80381080 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Serine at position 1511 (N1511S)
Ref Sequence ENSEMBL: ENSMUSP00000125063 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000160424] [ENSMUST00000162155]
AlphaFold E9Q7P2
Predicted Effect possibly damaging
Transcript: ENSMUST00000160424
AA Change: N1511S

PolyPhen 2 Score 0.937 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000125063
Gene: ENSMUSG00000022416
AA Change: N1511S

low complexity region 2 16 N/A INTRINSIC
low complexity region 24 40 N/A INTRINSIC
Pfam:Ion_trans 76 407 1.4e-79 PFAM
low complexity region 464 482 N/A INTRINSIC
low complexity region 531 554 N/A INTRINSIC
Pfam:Ion_trans 597 830 7.4e-58 PFAM
low complexity region 870 892 N/A INTRINSIC
low complexity region 919 940 N/A INTRINSIC
low complexity region 984 1015 N/A INTRINSIC
low complexity region 1069 1080 N/A INTRINSIC
Pfam:Ion_trans 1128 1401 7.8e-65 PFAM
Pfam:Ion_trans 1445 1700 9.4e-58 PFAM
Pfam:PKD_channel 1538 1694 1.4e-10 PFAM
low complexity region 1718 1739 N/A INTRINSIC
low complexity region 1744 1760 N/A INTRINSIC
low complexity region 1837 1853 N/A INTRINSIC
low complexity region 1922 1933 N/A INTRINSIC
low complexity region 1990 2005 N/A INTRINSIC
low complexity region 2041 2058 N/A INTRINSIC
low complexity region 2087 2097 N/A INTRINSIC
low complexity region 2103 2126 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000162155
AA Change: N1511S

PolyPhen 2 Score 0.747 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000125229
Gene: ENSMUSG00000022416
AA Change: N1511S

low complexity region 2 16 N/A INTRINSIC
low complexity region 24 40 N/A INTRINSIC
Pfam:Ion_trans 115 395 1.9e-66 PFAM
low complexity region 464 482 N/A INTRINSIC
low complexity region 531 554 N/A INTRINSIC
Pfam:Ion_trans 632 819 2.4e-45 PFAM
low complexity region 870 892 N/A INTRINSIC
low complexity region 919 940 N/A INTRINSIC
low complexity region 984 1015 N/A INTRINSIC
low complexity region 1069 1080 N/A INTRINSIC
Pfam:Ion_trans 1165 1389 6.2e-55 PFAM
coiled coil region 1394 1426 N/A INTRINSIC
Pfam:Ion_trans 1480 1688 1.9e-47 PFAM
Pfam:PKD_channel 1538 1694 4.8e-10 PFAM
low complexity region 1718 1739 N/A INTRINSIC
low complexity region 1744 1760 N/A INTRINSIC
Meta Mutation Damage Score 0.7543 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.1%
  • 20x: 93.5%
Validation Efficiency 99% (76/77)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the pore-forming alpha subunit of a voltage gated calcium channel. The encoded protein is a member of a subfamily of calcium channels referred to as is a low voltage-activated, T-type, calcium channel. The channel encoded by this protein is characterized by a slower activation and inactivation compared to other T-type calcium channels. This protein may be involved in calcium signaling in neurons. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Oct 2011]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930430A15Rik T C 2: 111,200,418 E382G probably damaging Het
4932414N04Rik C A 2: 68,717,228 Q161K probably benign Het
Aatk A T 11: 120,009,922 L1216Q probably damaging Het
Aifm3 T C 16: 17,503,671 F463L possibly damaging Het
Antxr2 C T 5: 97,960,637 W338* probably null Het
Apc2 T C 10: 80,304,967 S219P probably damaging Het
Arfgap3 A T 15: 83,308,188 probably null Het
Arrdc5 A G 17: 56,300,020 V75A possibly damaging Het
Atg16l2 A T 7: 101,300,110 probably null Het
Cad T C 5: 31,077,688 Y2095H probably damaging Het
Chia1 T C 3: 106,128,437 probably benign Het
Crybg2 A G 4: 134,074,454 D975G probably damaging Het
Dagla T C 19: 10,254,883 I480V probably damaging Het
Efl1 C T 7: 82,651,887 T33I probably damaging Het
Esp36 A G 17: 38,417,169 F74L probably benign Het
Faim T C 9: 98,992,096 probably benign Het
Fam83h G T 15: 76,003,927 H520Q probably benign Het
Fbn2 A T 18: 58,045,374 C1931S probably damaging Het
Frs3 A G 17: 47,701,656 D96G probably benign Het
Gbp4 A G 5: 105,121,840 M374T probably damaging Het
Gimap1 C T 6: 48,741,425 probably benign Het
Gm10010 A G 6: 128,200,613 noncoding transcript Het
Gm10355 T C 3: 101,306,898 noncoding transcript Het
Gmip C T 8: 69,811,445 probably benign Het
Gpc2 A T 5: 138,278,534 F110Y possibly damaging Het
Ifi44l C T 3: 151,762,759 V45M probably benign Het
Il15 T C 8: 82,343,261 E58G probably damaging Het
Kat2b T C 17: 53,644,743 probably benign Het
Kcnh7 C A 2: 62,777,510 V576L probably benign Het
Lrrc66 T A 5: 73,615,473 probably benign Het
Mical1 A G 10: 41,482,239 E416G probably benign Het
Mroh3 A G 1: 136,191,002 Y526H probably damaging Het
Mtx2 T C 2: 74,869,290 probably benign Het
Naip6 A T 13: 100,300,528 Y496N probably benign Het
Nfyc A G 4: 120,768,884 S73P probably benign Het
Olfr1418 C T 19: 11,855,123 V277M probably damaging Het
Olfr1418 A C 19: 11,855,368 V195G probably damaging Het
Olfr382 T A 11: 73,516,924 I92F probably damaging Het
Olfr810 T A 10: 129,791,232 D119V probably damaging Het
Olfr995 A G 2: 85,438,501 I219T probably benign Het
P2ry14 A G 3: 59,115,448 V206A probably benign Het
Polg G A 7: 79,460,148 probably benign Het
Ptgs1 G A 2: 36,240,856 probably benign Het
Pus7l A G 15: 94,523,417 S671P probably benign Het
Ralgapa2 T C 2: 146,342,192 T1547A probably benign Het
Rif1 T C 2: 52,111,588 S1685P probably benign Het
Rnf213 T C 11: 119,470,210 Y4452H probably damaging Het
Samd7 A G 3: 30,756,521 D229G probably benign Het
Serpina3j T C 12: 104,314,819 S84P possibly damaging Het
Slc35d1 A G 4: 103,213,244 probably benign Het
Sorbs2 A G 8: 45,796,310 D847G probably damaging Het
Sp110 A C 1: 85,577,329 F434C probably benign Het
Steap4 T C 5: 7,977,030 probably benign Het
Tg A C 15: 66,717,208 T13P probably damaging Het
Timeless T A 10: 128,244,673 Y474* probably null Het
Tmem94 T C 11: 115,792,060 probably null Het
Trdmt1 G A 2: 13,516,648 probably benign Het
Trim23 T C 13: 104,201,309 Y522H probably benign Het
Ttc13 A T 8: 124,674,366 S624T probably damaging Het
Txnl1 A G 18: 63,692,064 probably benign Het
Unkl T C 17: 25,208,083 probably benign Het
Usp54 T A 14: 20,589,369 probably benign Het
Vcam1 T C 3: 116,117,259 K497E possibly damaging Het
Vmn1r49 C A 6: 90,072,666 S118I possibly damaging Het
Vmn2r118 T C 17: 55,608,466 K495E probably benign Het
Wrnip1 G A 13: 32,821,090 C560Y possibly damaging Het
Xkr5 T C 8: 18,933,547 R660G probably benign Het
Zfp280c A G X: 48,548,703 probably benign Het
Zfp707 G A 15: 75,975,129 A291T possibly damaging Het
Other mutations in Cacna1i
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00421:Cacna1i APN 15 80382019 missense probably damaging 1.00
IGL00976:Cacna1i APN 15 80355645 missense probably benign
IGL01338:Cacna1i APN 15 80348380 missense probably damaging 0.99
IGL01589:Cacna1i APN 15 80387759 splice site probably benign
IGL01669:Cacna1i APN 15 80391757 missense probably benign
IGL01807:Cacna1i APN 15 80374147 missense probably damaging 1.00
IGL01911:Cacna1i APN 15 80391732 missense probably benign 0.09
IGL01973:Cacna1i APN 15 80382033 missense probably damaging 1.00
IGL02205:Cacna1i APN 15 80372951 missense probably benign 0.06
IGL02519:Cacna1i APN 15 80361874 nonsense probably null
IGL02648:Cacna1i APN 15 80298638 missense probably damaging 0.96
IGL03033:Cacna1i APN 15 80362239 missense probably damaging 0.98
IGL03214:Cacna1i APN 15 80355716 missense probably benign 0.30
R0067:Cacna1i UTSW 15 80381172 missense probably damaging 1.00
R0067:Cacna1i UTSW 15 80381172 missense probably damaging 1.00
R0295:Cacna1i UTSW 15 80356211 missense probably damaging 1.00
R0345:Cacna1i UTSW 15 80372462 missense probably damaging 0.98
R0415:Cacna1i UTSW 15 80368830 splice site probably benign
R0637:Cacna1i UTSW 15 80372654 missense probably damaging 0.99
R0840:Cacna1i UTSW 15 80358949 missense possibly damaging 0.85
R1463:Cacna1i UTSW 15 80379054 missense possibly damaging 0.96
R1528:Cacna1i UTSW 15 80391774 splice site probably null
R1563:Cacna1i UTSW 15 80321188 missense probably damaging 0.97
R1563:Cacna1i UTSW 15 80389855 splice site probably benign
R1573:Cacna1i UTSW 15 80393668 splice site probably null
R1654:Cacna1i UTSW 15 80389210 missense probably damaging 1.00
R1754:Cacna1i UTSW 15 80371529 missense probably damaging 0.99
R1794:Cacna1i UTSW 15 80389122 missense probably damaging 1.00
R1824:Cacna1i UTSW 15 80376789 missense possibly damaging 0.64
R1863:Cacna1i UTSW 15 80358931 missense probably damaging 1.00
R1885:Cacna1i UTSW 15 80358944 missense probably damaging 0.99
R1886:Cacna1i UTSW 15 80358944 missense probably damaging 0.99
R1899:Cacna1i UTSW 15 80391642 missense possibly damaging 0.91
R1907:Cacna1i UTSW 15 80375264 missense probably damaging 1.00
R1943:Cacna1i UTSW 15 80395044 missense probably benign
R2162:Cacna1i UTSW 15 80356187 missense probably damaging 1.00
R2888:Cacna1i UTSW 15 80374767 missense probably damaging 1.00
R3701:Cacna1i UTSW 15 80381071 splice site probably benign
R3702:Cacna1i UTSW 15 80381071 splice site probably benign
R3832:Cacna1i UTSW 15 80356187 missense probably damaging 1.00
R4852:Cacna1i UTSW 15 80388479 missense probably damaging 0.99
R4857:Cacna1i UTSW 15 80369662 missense probably damaging 1.00
R4950:Cacna1i UTSW 15 80368671 missense probably damaging 1.00
R4980:Cacna1i UTSW 15 80348449 missense probably damaging 0.97
R5217:Cacna1i UTSW 15 80390840 missense possibly damaging 0.94
R5437:Cacna1i UTSW 15 80371529 missense probably damaging 1.00
R5519:Cacna1i UTSW 15 80371499 missense probably damaging 1.00
R5642:Cacna1i UTSW 15 80395078 missense possibly damaging 0.47
R6217:Cacna1i UTSW 15 80389132 missense probably damaging 1.00
R6225:Cacna1i UTSW 15 80321226 missense probably damaging 1.00
R6251:Cacna1i UTSW 15 80336682 missense probably damaging 1.00
R6463:Cacna1i UTSW 15 80355758 missense probably damaging 0.97
R6490:Cacna1i UTSW 15 80378247 missense probably damaging 1.00
R6613:Cacna1i UTSW 15 80321259 missense probably damaging 1.00
R6884:Cacna1i UTSW 15 80374809 missense probably damaging 1.00
R6904:Cacna1i UTSW 15 80374801 missense probably damaging 1.00
R7017:Cacna1i UTSW 15 80380470 missense probably damaging 1.00
R7155:Cacna1i UTSW 15 80395238 missense probably benign 0.04
R7274:Cacna1i UTSW 15 80376822 missense possibly damaging 0.95
R7323:Cacna1i UTSW 15 80391653 missense possibly damaging 0.86
R7335:Cacna1i UTSW 15 80375575 missense probably damaging 1.00
R7571:Cacna1i UTSW 15 80375336 missense probably damaging 1.00
R7768:Cacna1i UTSW 15 80381188 missense probably damaging 1.00
R7820:Cacna1i UTSW 15 80372372 missense probably benign 0.00
R7987:Cacna1i UTSW 15 80320352 splice site probably null
R8150:Cacna1i UTSW 15 80375339 missense probably damaging 1.00
R8206:Cacna1i UTSW 15 80389815 splice site probably null
R8270:Cacna1i UTSW 15 80373634 missense probably damaging 0.99
R8382:Cacna1i UTSW 15 80376816 missense probably damaging 0.99
R8501:Cacna1i UTSW 15 80382046 critical splice donor site probably null
R8518:Cacna1i UTSW 15 80358894 nonsense probably null
R8552:Cacna1i UTSW 15 80320397 missense possibly damaging 0.69
R8679:Cacna1i UTSW 15 80375810 intron probably benign
R8696:Cacna1i UTSW 15 80381974 missense probably damaging 0.98
R8887:Cacna1i UTSW 15 80374693 missense possibly damaging 0.91
R9274:Cacna1i UTSW 15 80370153 missense probably damaging 1.00
R9379:Cacna1i UTSW 15 80375294 missense probably damaging 1.00
R9508:Cacna1i UTSW 15 80395171 missense probably benign 0.06
R9518:Cacna1i UTSW 15 80387777 missense probably damaging 1.00
R9674:Cacna1i UTSW 15 80380428 missense probably damaging 1.00
R9747:Cacna1i UTSW 15 80362117 missense probably benign 0.11
R9769:Cacna1i UTSW 15 80369592 missense probably damaging 1.00
X0022:Cacna1i UTSW 15 80361962 missense probably damaging 0.99
X0024:Cacna1i UTSW 15 80362139 missense probably benign 0.03
X0058:Cacna1i UTSW 15 80379102 missense probably damaging 1.00
Z1177:Cacna1i UTSW 15 80381179 missense possibly damaging 0.64
Z1177:Cacna1i UTSW 15 80389383 missense possibly damaging 0.94
Predicted Primers PCR Primer

Sequencing Primer
(F):5'- ttagaagtcagagtccatgcc -3'
Posted On 2013-07-11