Incidental Mutation 'R7389:Krt15'
ID573317
Institutional Source Beutler Lab
Gene Symbol Krt15
Ensembl Gene ENSMUSG00000054146
Gene Namekeratin 15
SynonymsK15, Krt1-15
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.086) question?
Stock #R7389 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location100131758-100135928 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 100135560 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 100 (V100E)
Ref Sequence ENSEMBL: ENSMUSP00000103034 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000107411]
Predicted Effect possibly damaging
Transcript: ENSMUST00000107411
AA Change: V100E

PolyPhen 2 Score 0.792 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000103034
Gene: ENSMUSG00000054146
AA Change: V100E

DomainStartEndE-ValueType
low complexity region 3 96 N/A INTRINSIC
Filament 97 409 5.06e-173 SMART
low complexity region 421 434 N/A INTRINSIC
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 98% (49/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the keratin gene family. The keratins are intermediate filament proteins responsible for the structural integrity of epithelial cells and are subdivided into cytokeratins and hair keratins. Most of the type I cytokeratins consist of acidic proteins which are arranged in pairs of heterotypic keratin chains and are clustered in a region on chromosome 17q21.2. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired esophageal epithelial regeneration with thicker epithelia due to enhanced basal cell proliferation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Anxa11 C A 14: 25,872,888 P182Q probably damaging Het
Asns C A 6: 7,689,291 L70F probably damaging Het
Cd163l1 A G 7: 140,228,791 K872E possibly damaging Het
Cntrl A T 2: 35,127,517 K445N probably benign Het
Cyp2c50 G T 19: 40,090,663 R150L probably benign Het
Dqx1 G T 6: 83,064,794 S539I probably null Het
Dusp9 TAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAG TAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAG X: 73,640,611 probably benign Het
Epha3 T C 16: 63,772,984 E247G probably damaging Het
Etl4 C T 2: 20,785,093 Q801* probably null Het
Fabp2 G T 3: 122,895,365 probably benign Het
Fsip2 G A 2: 82,988,796 V4958I possibly damaging Het
Fstl3 G A 10: 79,780,031 C117Y probably damaging Het
Hdgfl2 T G 17: 56,099,389 probably null Het
Igfn1 T C 1: 135,967,047 D1927G probably benign Het
Ino80 A C 2: 119,442,529 S489A probably benign Het
Lrriq3 A G 3: 155,188,104 T481A probably benign Het
Map2k3 A T 11: 60,932,036 probably benign Het
Matr3 A G 18: 35,584,585 T617A probably benign Het
Mybpc2 T G 7: 44,505,604 T960P probably benign Het
Ncoa2 T C 1: 13,186,825 N150S possibly damaging Het
Nup153 A T 13: 46,700,987 probably null Het
Obscn A G 11: 59,036,400 L5498P probably benign Het
Olfr111 A G 17: 37,530,657 R227G possibly damaging Het
Olfr1444 G T 19: 12,862,617 V281L probably benign Het
Paqr8 C A 1: 20,935,165 P181Q probably damaging Het
Pcdhgb4 T C 18: 37,722,363 Y604H probably damaging Het
Pja2 T A 17: 64,297,727 E487V probably damaging Het
Pnpla6 C T 8: 3,543,981 R1331* probably null Het
Ppl T A 16: 5,106,713 probably null Het
Rhbdl3 T A 11: 80,346,839 M299K possibly damaging Het
Slc26a9 A G 1: 131,769,248 *791W probably null Het
Slc7a2 A G 8: 40,912,515 Y461C probably benign Het
Sptb G T 12: 76,624,229 Q447K probably damaging Het
Ssh1 A T 5: 113,958,831 I205N probably benign Het
Stab1 C T 14: 31,147,239 V1511I probably benign Het
Tex19.1 T C 11: 121,147,160 W115R possibly damaging Het
Tinf2 G T 14: 55,680,710 probably null Het
Tmeff1 A G 4: 48,617,097 probably null Het
Tnip2 G T 5: 34,513,801 Q33K probably benign Het
Traf3 C A 12: 111,237,753 L59M probably damaging Het
Trav14d-3-dv8 T C 14: 53,078,871 Y63H possibly damaging Het
Trim11 C T 11: 58,990,655 S458L probably damaging Het
Tspan18 A T 2: 93,209,927 V161E probably benign Het
Usf3 T A 16: 44,217,941 V928E probably benign Het
Usp29 G A 7: 6,963,458 V767I possibly damaging Het
Usp34 T G 11: 23,345,200 F287L Het
Vmn1r213 T C 13: 23,012,386 C380R probably benign Het
Zfyve9 A G 4: 108,693,318 probably null Het
Other mutations in Krt15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02194:Krt15 APN 11 100132013 utr 3 prime probably benign
IGL02304:Krt15 APN 11 100133677 missense possibly damaging 0.79
R0361:Krt15 UTSW 11 100133181 missense probably benign 0.13
R1562:Krt15 UTSW 11 100133181 missense probably benign 0.13
R2113:Krt15 UTSW 11 100135658 missense unknown
R4858:Krt15 UTSW 11 100132071 missense probably benign 0.00
R5185:Krt15 UTSW 11 100133433 missense probably damaging 1.00
R6967:Krt15 UTSW 11 100134513 missense probably damaging 0.98
R7294:Krt15 UTSW 11 100132022 missense possibly damaging 0.71
R7371:Krt15 UTSW 11 100135560 missense possibly damaging 0.79
R7372:Krt15 UTSW 11 100135560 missense possibly damaging 0.79
R7390:Krt15 UTSW 11 100135560 missense possibly damaging 0.79
R7391:Krt15 UTSW 11 100135560 missense possibly damaging 0.79
R7392:Krt15 UTSW 11 100135560 missense possibly damaging 0.79
R7420:Krt15 UTSW 11 100135560 missense possibly damaging 0.79
R7421:Krt15 UTSW 11 100135560 missense possibly damaging 0.79
R7423:Krt15 UTSW 11 100135560 missense possibly damaging 0.79
R7424:Krt15 UTSW 11 100135560 missense possibly damaging 0.79
X0025:Krt15 UTSW 11 100135517 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TGTACTGAACACGAGCCACC -3'
(R):5'- GAAGCCGAAGTATCTCTGCTTCTTC -3'

Sequencing Primer
(F):5'- GACAGACTTACTTTGTCCCGG -3'
(R):5'- GAAGTATCTCTGCTTCTTCTGCTAGG -3'
Posted On2019-09-13