Incidental Mutation 'R7389:Tnip2'
ID573301
Institutional Source Beutler Lab
Gene Symbol Tnip2
Ensembl Gene ENSMUSG00000059866
Gene NameTNFAIP3 interacting protein 2
SynonymsABIN-2, 1810020H16Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.290) question?
Stock #R7389 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location34496087-34513991 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 34513801 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Lysine at position 33 (Q33K)
Ref Sequence ENSEMBL: ENSMUSP00000030991 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030991] [ENSMUST00000087737] [ENSMUST00000114359]
Predicted Effect probably benign
Transcript: ENSMUST00000030991
AA Change: Q33K

PolyPhen 2 Score 0.037 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000030991
Gene: ENSMUSG00000059866
AA Change: Q33K

DomainStartEndE-ValueType
coiled coil region 30 123 N/A INTRINSIC
Pfam:EABR 236 269 7.2e-21 PFAM
Pfam:CC2-LZ 264 364 5.5e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000087737
AA Change: Q33K

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000085030
Gene: ENSMUSG00000059866
AA Change: Q33K

DomainStartEndE-ValueType
coiled coil region 30 123 N/A INTRINSIC
Pfam:EABR 215 249 4.9e-23 PFAM
coiled coil region 256 341 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114359
AA Change: Q33K

PolyPhen 2 Score 0.028 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000109999
Gene: ENSMUSG00000059866
AA Change: Q33K

DomainStartEndE-ValueType
coiled coil region 30 123 N/A INTRINSIC
coiled coil region 225 258 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 98% (49/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which acts as an inhibitor of NFkappaB activation. The encoded protein is also involved in MAP/ERK signaling pathway in specific cell types. It may be involved in apoptosis of endothelial cells. Alternative splicing results in multiple transcript variants. A pseudogene related to this gene is located on the X chromosome.[provided by RefSeq, May 2014]
PHENOTYPE: Mice homozygous for a null allele have impaired IL-1 response and macrophage physiology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Anxa11 C A 14: 25,872,888 P182Q probably damaging Het
Asns C A 6: 7,689,291 L70F probably damaging Het
Cd163l1 A G 7: 140,228,791 K872E possibly damaging Het
Cntrl A T 2: 35,127,517 K445N probably benign Het
Cyp2c50 G T 19: 40,090,663 R150L probably benign Het
Dqx1 G T 6: 83,064,794 S539I probably null Het
Dusp9 TAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAG TAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAG X: 73,640,611 probably benign Het
Epha3 T C 16: 63,772,984 E247G probably damaging Het
Etl4 C T 2: 20,785,093 Q801* probably null Het
Fabp2 G T 3: 122,895,365 probably benign Het
Fsip2 G A 2: 82,988,796 V4958I possibly damaging Het
Fstl3 G A 10: 79,780,031 C117Y probably damaging Het
Hdgfl2 T G 17: 56,099,389 probably null Het
Igfn1 T C 1: 135,967,047 D1927G probably benign Het
Ino80 A C 2: 119,442,529 S489A probably benign Het
Krt15 A T 11: 100,135,560 V100E possibly damaging Het
Lrriq3 A G 3: 155,188,104 T481A probably benign Het
Map2k3 A T 11: 60,932,036 probably benign Het
Matr3 A G 18: 35,584,585 T617A probably benign Het
Mybpc2 T G 7: 44,505,604 T960P probably benign Het
Ncoa2 T C 1: 13,186,825 N150S possibly damaging Het
Nup153 A T 13: 46,700,987 probably null Het
Obscn A G 11: 59,036,400 L5498P probably benign Het
Olfr111 A G 17: 37,530,657 R227G possibly damaging Het
Olfr1444 G T 19: 12,862,617 V281L probably benign Het
Paqr8 C A 1: 20,935,165 P181Q probably damaging Het
Pcdhgb4 T C 18: 37,722,363 Y604H probably damaging Het
Pja2 T A 17: 64,297,727 E487V probably damaging Het
Pnpla6 C T 8: 3,543,981 R1331* probably null Het
Ppl T A 16: 5,106,713 probably null Het
Rhbdl3 T A 11: 80,346,839 M299K possibly damaging Het
Slc26a9 A G 1: 131,769,248 *791W probably null Het
Slc7a2 A G 8: 40,912,515 Y461C probably benign Het
Sptb G T 12: 76,624,229 Q447K probably damaging Het
Ssh1 A T 5: 113,958,831 I205N probably benign Het
Stab1 C T 14: 31,147,239 V1511I probably benign Het
Tex19.1 T C 11: 121,147,160 W115R possibly damaging Het
Tinf2 G T 14: 55,680,710 probably null Het
Tmeff1 A G 4: 48,617,097 probably null Het
Traf3 C A 12: 111,237,753 L59M probably damaging Het
Trav14d-3-dv8 T C 14: 53,078,871 Y63H possibly damaging Het
Trim11 C T 11: 58,990,655 S458L probably damaging Het
Tspan18 A T 2: 93,209,927 V161E probably benign Het
Usf3 T A 16: 44,217,941 V928E probably benign Het
Usp29 G A 7: 6,963,458 V767I possibly damaging Het
Usp34 T G 11: 23,345,200 F287L Het
Vmn1r213 T C 13: 23,012,386 C380R probably benign Het
Zfyve9 A G 4: 108,693,318 probably null Het
Other mutations in Tnip2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00754:Tnip2 APN 5 34499299 missense probably benign 0.29
IGL01980:Tnip2 APN 5 34496868 missense probably benign 0.17
IGL02649:Tnip2 APN 5 34513731 missense probably damaging 1.00
IGL03122:Tnip2 APN 5 34503751 missense possibly damaging 0.94
PIT4445001:Tnip2 UTSW 5 34496871 missense probably benign 0.41
R1713:Tnip2 UTSW 5 34503831 splice site probably benign
R1782:Tnip2 UTSW 5 34499668 missense probably benign 0.21
R2183:Tnip2 UTSW 5 34499613 intron probably benign
R2184:Tnip2 UTSW 5 34499613 intron probably benign
R4417:Tnip2 UTSW 5 34503581 nonsense probably null
R5216:Tnip2 UTSW 5 34503805 missense probably damaging 0.99
R5254:Tnip2 UTSW 5 34503578 missense probably damaging 0.99
R5287:Tnip2 UTSW 5 34513764 missense probably damaging 1.00
R5403:Tnip2 UTSW 5 34513764 missense probably damaging 1.00
R5839:Tnip2 UTSW 5 34496632 utr 3 prime probably benign
R6355:Tnip2 UTSW 5 34499197 nonsense probably null
R6379:Tnip2 UTSW 5 34503635 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCACTCGCTCCAACAAGTTC -3'
(R):5'- ACCTAGAATGGAGCTGGTGTG -3'

Sequencing Primer
(F):5'- ACAAGTTCCCCAGGCCG -3'
(R):5'- CTAGAATGGAGCTGGTGTGTCAAG -3'
Posted On2019-09-13