Incidental Mutation 'R7431:Col5a3'
ID576478
Institutional Source Beutler Lab
Gene Symbol Col5a3
Ensembl Gene ENSMUSG00000004098
Gene Namecollagen, type V, alpha 3
SynonymsPro-alpha3(V)
MMRRC Submission
Accession Numbers

Ncbi RefSeq: NM_016919.2; MGI:1858212

Is this an essential gene? Probably non essential (E-score: 0.249) question?
Stock #R7431 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location20770050-20815067 bp(-) (GRCm38)
Type of Mutationmakesense
DNA Base Change (assembly) T to C at 20770835 bp
ZygosityHeterozygous
Amino Acid Change Stop codon to Tryptophan at position 1740 (*1740W)
Ref Sequence ENSEMBL: ENSMUSP00000004201 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004201]
Predicted Effect probably null
Transcript: ENSMUST00000004201
AA Change: *1740W
SMART Domains Protein: ENSMUSP00000004201
Gene: ENSMUSG00000004098
AA Change: *1740W

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
TSPN 32 211 7.08e-28 SMART
LamG 89 210 2.13e-2 SMART
low complexity region 247 267 N/A INTRINSIC
low complexity region 295 314 N/A INTRINSIC
low complexity region 341 347 N/A INTRINSIC
low complexity region 369 381 N/A INTRINSIC
low complexity region 391 434 N/A INTRINSIC
low complexity region 461 474 N/A INTRINSIC
Pfam:Collagen 475 538 5.5e-10 PFAM
low complexity region 597 616 N/A INTRINSIC
low complexity region 628 694 N/A INTRINSIC
internal_repeat_3 703 737 7.13e-16 PROSPERO
low complexity region 742 821 N/A INTRINSIC
low complexity region 823 844 N/A INTRINSIC
low complexity region 859 889 N/A INTRINSIC
internal_repeat_2 892 1081 5.05e-17 PROSPERO
internal_repeat_1 996 1133 7.47e-22 PROSPERO
internal_repeat_3 1105 1139 7.13e-16 PROSPERO
low complexity region 1140 1165 N/A INTRINSIC
low complexity region 1168 1255 N/A INTRINSIC
low complexity region 1258 1282 N/A INTRINSIC
low complexity region 1285 1306 N/A INTRINSIC
low complexity region 1311 1418 N/A INTRINSIC
Pfam:Collagen 1429 1491 9.5e-10 PFAM
COLFI 1508 1738 7.98e-92 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.3%
Validation Efficiency 97% (77/79)
MGI Phenotype Strain: 5000519
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an alpha chain for one of the low abundance fibrillar collagens. Fibrillar collagen molecules are trimers that can be composed of one or more types of alpha chains. Type V collagen is found in tissues containing type I collagen and appears to regulate the assembly of heterotypic fibers composed of both type I and type V collagen. This gene product is closely related to type XI collagen and it is possible that the collagen chains of types V and XI constitute a single collagen type with tissue-specific chain combinations. Mutations in this gene are thought to be responsible for the symptoms of a subset of patients with Ehlers-Danlos syndrome type III. Messages of several sizes can be detected in northern blots but sequence information cannot confirm the identity of the shorter messages. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null mutation show decreased pancreatic beta cell mass, hyperglycemia, hypoinsulinemia, impaired glucose tolerance, insulin resistance and impaired glucose uptake. Homozygous females show decreased susceptibility to diet-induced obesity and a thin hypodermal fat layer. [provided by MGI curators]
Allele List at MGI

All alleles(3) : Targeted(3)

Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921530L21Rik A G 14: 95,881,837 H10R probably benign Het
4931406P16Rik T C 7: 34,284,794 I135V possibly damaging Het
Abca9 CA C 11: 110,127,426 probably null Het
Abcf3 G T 16: 20,558,789 R510L probably benign Het
Abcg4 T A 9: 44,274,700 I625F possibly damaging Het
Adam22 A T 5: 8,092,818 S806T probably damaging Het
Adcy4 T C 14: 55,772,672 I718V probably benign Het
Adgb A T 10: 10,391,955 probably null Het
Aldoart1 T A 4: 72,851,441 K377* probably null Het
Apc2 T A 10: 80,302,183 V100E possibly damaging Het
Asxl3 T G 18: 22,516,953 D666E probably damaging Het
Atg4c A T 4: 99,221,395 I200F possibly damaging Het
Atp1a4 A G 1: 172,250,907 F255L probably benign Het
Bod1l A C 5: 41,813,120 probably null Het
Cacna2d4 A T 6: 119,244,276 T250S probably damaging Het
Ccdc114 T G 7: 45,929,246 L81R probably damaging Het
Ccng1 G A 11: 40,753,918 R51W possibly damaging Het
Chd6 T C 2: 161,026,328 E366G possibly damaging Het
Clca4b A T 3: 144,911,133 S919T probably benign Het
Col6a5 A T 9: 105,928,269 I1146K unknown Het
Cpxm1 T C 2: 130,394,046 T399A probably benign Het
Cpz T C 5: 35,511,142 T375A probably benign Het
Cyp2b13 T A 7: 26,061,551 V11D probably damaging Het
Cyp39a1 A G 17: 43,683,015 T189A probably benign Het
Desi2 C T 1: 178,256,441 Q52* probably null Het
Dhx15 A G 5: 52,162,611 V418A probably damaging Het
Dnah3 T A 7: 120,051,744 M978L probably damaging Het
Dpagt1 T A 9: 44,326,087 C17* probably null Het
Dph5 A T 3: 115,892,732 K52N possibly damaging Het
Dpp4 G T 2: 62,352,238 N566K probably benign Het
Elavl4 T C 4: 110,226,633 Y94C probably damaging Het
Fat2 G A 11: 55,309,101 T1049I probably damaging Het
Fat4 T A 3: 39,009,157 Y4421N possibly damaging Het
Fcrls C A 3: 87,258,926 A181S probably damaging Het
Glg1 G T 8: 111,160,754 N456K unknown Het
Gm10228 A G 16: 89,041,213 S68P unknown Het
Golga4 G A 9: 118,559,731 E1974K probably damaging Het
Heatr9 G T 11: 83,519,268 P49Q probably damaging Het
Hmgxb3 A T 18: 61,147,445 V662D probably damaging Het
Hs3st4 T C 7: 123,983,290 L37P probably damaging Het
Ifi205 A T 1: 174,028,377 M29K probably benign Het
Igkv1-35 C T 6: 70,011,004 V103M probably damaging Het
Klf13 T A 7: 63,891,756 K208* probably null Het
Klhl36 A G 8: 119,870,382 N274S probably benign Het
Mosmo T A 7: 120,730,650 L165I probably benign Het
Mtcl1 G A 17: 66,342,906 Q1855* probably null Het
Muc16 A G 9: 18,607,993 V208A Het
Nin T G 12: 70,078,223 R108S Het
Olfr159 T C 4: 43,770,882 N43S probably damaging Het
Polr1a G A 6: 71,926,659 V319I probably benign Het
Pramel7 A G 2: 87,489,938 V337A possibly damaging Het
Prkar2b A T 12: 31,963,151 probably null Het
R3hdm2 T A 10: 127,458,147 M170K probably benign Het
Rbm26 A G 14: 105,117,092 I919T possibly damaging Het
Rimkla A G 4: 119,477,811 M125T probably benign Het
Sag T A 1: 87,821,337 F153I possibly damaging Het
Sbf2 G T 7: 110,351,750 D1163E probably damaging Het
Scgb2b24 T C 7: 33,739,249 I13V probably benign Het
Scin G A 12: 40,133,922 H63Y probably damaging Het
Sele A G 1: 164,051,620 T275A probably damaging Het
Slc22a15 T A 3: 101,897,940 T144S probably benign Het
Slc8a1 T A 17: 81,441,663 K650I probably benign Het
Slc9c1 G T 16: 45,593,484 V992F probably damaging Het
Spag16 A T 1: 69,923,872 T393S unknown Het
Taf15 G A 11: 83,504,953 D495N unknown Het
Tas2r144 T A 6: 42,215,974 I216N probably damaging Het
Tbccd1 G T 16: 22,825,813 P271Q probably benign Het
Tcf4 C A 18: 69,347,178 probably null Het
Thap4 A T 1: 93,750,501 S188T probably benign Het
Trank1 T C 9: 111,362,402 V493A probably benign Het
Trip11 A G 12: 101,884,019 V1262A possibly damaging Het
Tspan2 T A 3: 102,749,791 W35R probably damaging Het
Usp39 G T 6: 72,336,268 T313N possibly damaging Het
Vmn2r83 T A 10: 79,491,472 L638Q probably damaging Het
Vps29 T C 5: 122,354,478 V2A probably benign Het
Wrap53 A G 11: 69,578,487 F148L possibly damaging Het
Znfx1 T C 2: 167,055,792 Y404C probably damaging Het
Zrsr1 A G 11: 22,973,580 E118G probably benign Het
Other mutations in Col5a3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00834:Col5a3 APN 9 20786389 nonsense probably null
IGL01548:Col5a3 APN 9 20803000 splice site probably benign
IGL02164:Col5a3 APN 9 20792643 critical splice donor site probably null
IGL02297:Col5a3 APN 9 20772154 missense unknown
IGL02333:Col5a3 APN 9 20799306 missense unknown
IGL02349:Col5a3 APN 9 20772361 missense unknown
IGL02390:Col5a3 APN 9 20776996 missense unknown
IGL02685:Col5a3 APN 9 20772205 missense unknown
IGL02941:Col5a3 APN 9 20804666 missense unknown
IGL03001:Col5a3 APN 9 20807744 missense unknown
IGL03061:Col5a3 APN 9 20797572 critical splice donor site probably null
IGL03102:Col5a3 APN 9 20804635 critical splice donor site probably null
IGL03308:Col5a3 APN 9 20808379 missense unknown
IGL03372:Col5a3 APN 9 20775328 missense unknown
R0002:Col5a3 UTSW 9 20809856 critical splice acceptor site probably null
R0012:Col5a3 UTSW 9 20777108 splice site probably benign
R0316:Col5a3 UTSW 9 20775325 missense unknown
R0357:Col5a3 UTSW 9 20807768 splice site probably benign
R0360:Col5a3 UTSW 9 20772466 missense unknown
R0483:Col5a3 UTSW 9 20782481 splice site probably null
R0485:Col5a3 UTSW 9 20782708 missense probably damaging 0.99
R0627:Col5a3 UTSW 9 20775485 missense unknown
R1035:Col5a3 UTSW 9 20793499 splice site probably benign
R1051:Col5a3 UTSW 9 20775235 missense unknown
R1295:Col5a3 UTSW 9 20808418 missense unknown
R1438:Col5a3 UTSW 9 20779957 missense probably damaging 0.99
R1622:Col5a3 UTSW 9 20772220 missense unknown
R1668:Col5a3 UTSW 9 20771096 missense unknown
R1680:Col5a3 UTSW 9 20784668 critical splice donor site probably null
R2112:Col5a3 UTSW 9 20809777 missense unknown
R2149:Col5a3 UTSW 9 20771270 missense unknown
R2159:Col5a3 UTSW 9 20771310 missense unknown
R2939:Col5a3 UTSW 9 20795658 missense unknown
R3236:Col5a3 UTSW 9 20807653 missense unknown
R3845:Col5a3 UTSW 9 20808377 missense unknown
R4598:Col5a3 UTSW 9 20774559 critical splice donor site probably null
R4599:Col5a3 UTSW 9 20774559 critical splice donor site probably null
R4611:Col5a3 UTSW 9 20814896 unclassified probably benign
R4713:Col5a3 UTSW 9 20793574 missense unknown
R4723:Col5a3 UTSW 9 20809591 missense unknown
R5209:Col5a3 UTSW 9 20778643 intron probably benign
R5336:Col5a3 UTSW 9 20799301 missense unknown
R5378:Col5a3 UTSW 9 20797576 missense unknown
R5614:Col5a3 UTSW 9 20783476 splice site probably benign
R5775:Col5a3 UTSW 9 20801072 missense unknown
R5895:Col5a3 UTSW 9 20772442 missense unknown
R6048:Col5a3 UTSW 9 20807619 missense unknown
R6265:Col5a3 UTSW 9 20793764 missense unknown
R6372:Col5a3 UTSW 9 20785586 missense probably damaging 0.99
R6520:Col5a3 UTSW 9 20774052 missense unknown
R6558:Col5a3 UTSW 9 20779033 missense probably damaging 1.00
R6608:Col5a3 UTSW 9 20774019 missense unknown
R6679:Col5a3 UTSW 9 20779033 missense probably damaging 1.00
R6680:Col5a3 UTSW 9 20779033 missense probably damaging 1.00
R6696:Col5a3 UTSW 9 20779033 missense probably damaging 1.00
R6698:Col5a3 UTSW 9 20779033 missense probably damaging 1.00
R6700:Col5a3 UTSW 9 20779033 missense probably damaging 1.00
R6708:Col5a3 UTSW 9 20775035 missense unknown
R6712:Col5a3 UTSW 9 20779033 missense probably damaging 1.00
R6714:Col5a3 UTSW 9 20779033 missense probably damaging 1.00
R6828:Col5a3 UTSW 9 20798452 missense unknown
R7343:Col5a3 UTSW 9 20793946 critical splice donor site probably null
R7500:Col5a3 UTSW 9 20800289 missense unknown
R7592:Col5a3 UTSW 9 20797393 missense unknown
R7671:Col5a3 UTSW 9 20775086 critical splice acceptor site probably null
Z1177:Col5a3 UTSW 9 20775334 missense unknown
Predicted Primers PCR Primer
(F):5'- GACAACTGGGTATACCACCTG -3'
(R):5'- TCGGGTAAGACCATGGAACC -3'

Sequencing Primer
(F):5'- ACCTGGGGTGAACAGACAG -3'
(R):5'- TGGAGTGGGGAAGCCTCTC -3'
Posted On2019-10-07