Incidental Mutation 'R7442:Mylk2'
ID576998
Institutional Source Beutler Lab
Gene Symbol Mylk2
Ensembl Gene ENSMUSG00000027470
Gene Namemyosin, light polypeptide kinase 2, skeletal muscle
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.305) question?
Stock #R7442 (G1)
Quality Score148.008
Status Validated
Chromosome2
Chromosomal Location152911352-152923068 bp(+) (GRCm38)
Type of Mutationstart gained
DNA Base Change (assembly) T to G at 152911426 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000028970 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028970]
Predicted Effect probably benign
Transcript: ENSMUST00000028970
SMART Domains Protein: ENSMUSP00000028970
Gene: ENSMUSG00000027470

DomainStartEndE-ValueType
low complexity region 90 122 N/A INTRINSIC
low complexity region 142 157 N/A INTRINSIC
low complexity region 216 228 N/A INTRINSIC
low complexity region 278 285 N/A INTRINSIC
S_TKc 302 557 6.08e-87 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (76/76)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a myosin light chain kinase, a calcium/calmodulin dependent enzyme, that is exclusively expressed in adult skeletal muscle. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous knockout mice display impaired skeletal muscle twitch tension response to tetanic stimulation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700011L22Rik A G 8: 79,220,290 I109T probably damaging Het
A430033K04Rik T C 5: 138,647,247 S465P possibly damaging Het
Acap3 T C 4: 155,905,621 F753L probably damaging Het
Adam9 A T 8: 24,967,207 V635E probably damaging Het
Adgre4 T A 17: 55,852,340 V675E probably benign Het
Anapc4 T C 5: 52,857,201 Y469H probably benign Het
Ankdd1b T G 13: 96,424,760 K325N possibly damaging Het
Aox1 T C 1: 58,082,013 V881A probably damaging Het
Arhgap5 A G 12: 52,516,956 T237A probably benign Het
Asah1 T C 8: 41,343,565 D331G possibly damaging Het
Atp5a1 G A 18: 77,779,120 R231H probably benign Het
Bod1l G A 5: 41,807,179 P2694L probably damaging Het
Bst1 T C 5: 43,821,742 S143P probably benign Het
Cacna1b A C 2: 24,607,501 S2132A probably benign Het
Caps2 G T 10: 112,208,354 R486L probably damaging Het
Cd68 T C 11: 69,665,928 T18A probably benign Het
Cdk8 T C 5: 146,292,769 probably null Het
Col18a1 A T 10: 77,096,238 I127N unknown Het
Dsc3 T C 18: 19,981,156 D347G probably damaging Het
Dusp27 T C 1: 166,101,015 K343E probably benign Het
Dyrk2 T C 10: 118,859,881 S491G probably damaging Het
Edem1 T A 6: 108,851,305 Y530* probably null Het
Enc1 A T 13: 97,246,740 H586L probably benign Het
Ephb6 T G 6: 41,618,047 probably null Het
Etv5 G T 16: 22,436,059 Q48K probably damaging Het
Exoc3l A G 8: 105,292,926 W404R probably damaging Het
Fbn1 C A 2: 125,403,212 A252S possibly damaging Het
Foxe3 A G 4: 114,925,293 S241P unknown Het
Gm49380 T A 9: 44,112,412 M180L probably benign Het
Gm8251 A G 1: 44,058,708 S1077P possibly damaging Het
Hoxd1 A T 2: 74,763,559 D153V probably damaging Het
Ifi207 C T 1: 173,727,431 S895N probably benign Het
Igf1r G A 7: 68,173,278 V385M probably damaging Het
Ints9 C T 14: 64,995,064 Q191* probably null Het
Ktn1 A G 14: 47,714,640 E979G probably benign Het
Lama3 G A 18: 12,472,181 probably null Het
Lrtm2 C T 6: 119,317,431 M246I probably damaging Het
Mdm1 T C 10: 118,146,685 V75A probably benign Het
Mia3 T C 1: 183,358,876 E165G probably benign Het
Mrps21 T C 3: 95,862,816 E67G probably damaging Het
Mybpc1 A C 10: 88,526,293 I995S probably damaging Het
Myo16 G A 8: 10,272,537 C11Y probably damaging Het
Nudt18 A C 14: 70,579,358 D134A probably benign Het
Obox1 G T 7: 15,555,566 K93N probably benign Het
Olfr1019 A T 2: 85,841,752 V13D probably benign Het
Olfr102 T A 17: 37,313,925 H153L possibly damaging Het
Olfr457 A T 6: 42,471,500 M226K probably benign Het
Olfr684 T C 7: 105,157,082 Y200C probably damaging Het
Pkd2l1 T C 19: 44,157,229 H185R probably benign Het
Ptpn18 A G 1: 34,462,750 T48A probably benign Het
Ptprd A T 4: 76,059,821 Y583* probably null Het
Ptprk G A 10: 28,574,819 G992D probably damaging Het
Setdb2 A G 14: 59,419,251 F206L probably damaging Het
Slain1 A G 14: 103,685,714 D247G probably damaging Het
Slc10a2 A T 8: 5,089,086 V286E possibly damaging Het
Slc44a2 C T 9: 21,345,523 T367I probably damaging Het
Slco4a1 T C 2: 180,474,126 V685A probably benign Het
Srp54c T A 12: 55,255,562 Y333N probably damaging Het
Srrm2 T C 17: 23,820,117 S1912P unknown Het
St7l A G 3: 104,889,329 T253A possibly damaging Het
Sun3 T G 11: 9,031,445 Y53S possibly damaging Het
Tktl2 A G 8: 66,512,909 N373S possibly damaging Het
Tmco3 T A 8: 13,320,781 S648R probably damaging Het
Tmem178 T A 17: 80,944,756 V23D probably damaging Het
Tmem229a C A 6: 24,955,690 G22W probably damaging Het
Top3a C T 11: 60,753,918 S320N possibly damaging Het
Treml1 C A 17: 48,366,691 D243E probably damaging Het
Trim42 C T 9: 97,362,945 V601M probably damaging Het
Ttn A G 2: 76,743,006 S25848P probably damaging Het
Vmn1r86 A T 7: 13,102,056 F298I possibly damaging Het
Vmn2r96 T C 17: 18,573,400 F2S probably benign Het
Xpc A G 6: 91,504,649 L230P probably damaging Het
Xpo4 A G 14: 57,630,223 V189A probably benign Het
Zfhx3 A G 8: 108,792,836 T197A probably damaging Het
Zswim1 A G 2: 164,825,790 K321E probably damaging Het
Other mutations in Mylk2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01870:Mylk2 APN 2 152915214 missense probably benign 0.20
IGL02097:Mylk2 APN 2 152915136 missense probably damaging 0.98
IGL02158:Mylk2 APN 2 152919157 missense probably damaging 1.00
IGL02189:Mylk2 APN 2 152915154 missense probably damaging 1.00
IGL02243:Mylk2 APN 2 152920553 missense probably damaging 1.00
IGL02716:Mylk2 APN 2 152922153 makesense probably null
IGL02946:Mylk2 APN 2 152919210 nonsense probably null
IGL03105:Mylk2 APN 2 152917359 missense possibly damaging 0.94
R1184:Mylk2 UTSW 2 152913741 critical splice donor site probably null
R1443:Mylk2 UTSW 2 152919416 missense probably damaging 1.00
R1957:Mylk2 UTSW 2 152917607 missense possibly damaging 0.86
R2496:Mylk2 UTSW 2 152913668 missense probably damaging 1.00
R2870:Mylk2 UTSW 2 152919348 missense probably damaging 1.00
R2870:Mylk2 UTSW 2 152919348 missense probably damaging 1.00
R3081:Mylk2 UTSW 2 152919354 missense probably benign 0.31
R4510:Mylk2 UTSW 2 152917410 missense probably damaging 1.00
R4511:Mylk2 UTSW 2 152917410 missense probably damaging 1.00
R4600:Mylk2 UTSW 2 152917556 missense probably damaging 1.00
R4633:Mylk2 UTSW 2 152917415 missense probably benign 0.00
R4890:Mylk2 UTSW 2 152920354 missense possibly damaging 0.88
R5267:Mylk2 UTSW 2 152913549 missense probably benign
R5430:Mylk2 UTSW 2 152917548 missense probably damaging 1.00
R5447:Mylk2 UTSW 2 152912510 missense probably damaging 0.96
R6167:Mylk2 UTSW 2 152915753 splice site probably null
R6327:Mylk2 UTSW 2 152913693 missense possibly damaging 0.77
R6391:Mylk2 UTSW 2 152917395 missense probably damaging 1.00
R6913:Mylk2 UTSW 2 152913690 missense possibly damaging 0.76
R7066:Mylk2 UTSW 2 152911668 intron probably null
R7092:Mylk2 UTSW 2 152915190 missense probably benign 0.21
R7403:Mylk2 UTSW 2 152917341 missense probably damaging 1.00
R7443:Mylk2 UTSW 2 152911426 start gained probably benign
R7453:Mylk2 UTSW 2 152912433 missense probably damaging 1.00
R7477:Mylk2 UTSW 2 152920341 missense probably damaging 1.00
R7529:Mylk2 UTSW 2 152915704 missense probably damaging 1.00
R8029:Mylk2 UTSW 2 152920299 missense probably damaging 1.00
Z1177:Mylk2 UTSW 2 152920330 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGGTGTCAAAGATCCTCCTCTTAG -3'
(R):5'- AACATCCCTTCTGAGGCTCC -3'

Sequencing Primer
(F):5'- AAAGATCCTCCTCTTAGTCTCCG -3'
(R):5'- GGCTTGGCACCTGTTGAC -3'
Posted On2019-10-07